Journal: American Journal of Cancer Research

Article Title: ELOVL2: a novel tumor suppressor attenuating tamoxifen resistance in breast cancer

doi:

Figure Lengend Snippet: Optimization of plasmid and siRNA transfection into cultured cells. MCF-7/TamR cells are transiently transfected with an ORF to induce upregulation or with a siRNA to induce downregulation of the indicated gene. A. Overexpression of ELOVL2. Recombinant plasmid DNA (1-2 μg/mL) is transfected, and 2 μg/mL is used for further transfection. B. Expression of ELOVL2 is confirmed by qPCR and Western blot analysis. C. Downregulation of THEM4 using siRNA, as judged by qPCR. Two siRNAs targeting different sites of THEM4 were used in MCF-7/TamR cells (left) and MCF-7/TamR ELOVL2 ORF cells (right).

Article Snippet: ELOVL2 ( {"type":"entrez-nucleotide","attrs":{"text":"NM_017770","term_id":"1519313823","term_text":"NM_017770"}} NM_017770 ) Human ORF Clone Lenti Particle (Cat. No. RC209232L4V) , , , , Origene.

Techniques: Plasmid Preparation, Transfection, Cell Culture, Over Expression, Recombinant, Expressing, Western Blot

Journal: American Journal of Cancer Research

Article Title: ELOVL2: a novel tumor suppressor attenuating tamoxifen resistance in breast cancer

doi:

Figure Lengend Snippet: Information of primers for qPCR and siRNAs employed in this study

Article Snippet: ELOVL2 ( {"type":"entrez-nucleotide","attrs":{"text":"NM_017770","term_id":"1519313823","term_text":"NM_017770"}} NM_017770 ) Human ORF Clone Lenti Particle (Cat. No. RC209232L4V) , , , , Origene.

Techniques: Sequencing, Negative Control, Plasmid Preparation

Journal: American Journal of Cancer Research

Article Title: ELOVL2: a novel tumor suppressor attenuating tamoxifen resistance in breast cancer

doi:

Figure Lengend Snippet: Top 20 genes of which methylation are highly altered in the MCF-7/TamR cells

Article Snippet: ELOVL2 ( {"type":"entrez-nucleotide","attrs":{"text":"NM_017770","term_id":"1519313823","term_text":"NM_017770"}} NM_017770 ) Human ORF Clone Lenti Particle (Cat. No. RC209232L4V) , , , , Origene.

Techniques: Methylation

Journal: American Journal of Cancer Research

Article Title: ELOVL2: a novel tumor suppressor attenuating tamoxifen resistance in breast cancer

doi:

Figure Lengend Snippet: ELOVL2 is hypermethylated and downregulated in TamR breast cancer. A. Downregulation of ELOVL2 in MCF-7/TamR. Expression of ELOVL2 is examined by Western blot analysis. B. Demethylation of CpGs is induced by Aza in the MCF-7/TamR cells and ELOVL2 expression is analyzed by qPCR. C. Hypermethylation and downregulation of ELOVL2 in breast cancer tissues. MSP and qPCR are performed for breast tissues from Tam-sensitive and Tam-resistant cancer patients. N: number of samples. D. Immunohistochemical analysis of ELOVL2 in Tam-sensitive and Tam-resistant cancer tissues. Three tissue sets are analyzed and the protein expression is denoted by the bar graph. Images from two tissue sets are represented. Scale bar, 50 μm. E. Kaplan-Meier survival analysis of ELOVL2 expression in breast cancer. Samples (n = 1,746) are stratified into two groups based on ELOVL2 expression level. The log-rank test is performed in all tumor samples using distant metastasis-free survival (DMFS) as the endpoint. High ELOVL2 expression is significantly associated with higher DMFS in cancer patients (P < 0.005).

Article Snippet: ELOVL2 ( {"type":"entrez-nucleotide","attrs":{"text":"NM_017770","term_id":"1519313823","term_text":"NM_017770"}} NM_017770 ) Human ORF Clone Lenti Particle (Cat. No. RC209232L4V) , , , , Origene.

Techniques: Expressing, Western Blot, Immunohistochemical staining

Journal: American Journal of Cancer Research

Article Title: ELOVL2: a novel tumor suppressor attenuating tamoxifen resistance in breast cancer

doi:

Figure Lengend Snippet: TamR cancer cells show a lowered ELOVL2 expression and grow faster in xenograft tumor tissue. (A) ELOVL2 is upregulated in MCF-7/TamR by transiently transfecting a recombinant plasmid vector. Effect of ELOVL2 on cell proliferation is examined by CCK assay. (B) MCF-7/TamR cells grow faster than MCF-7 in a xenograft animal model. MCF-7 and MCF-7/TamR cells are subcutaneously injected into nude mice and the tumor volume is measured for 7 weeks. n = 8. (C) Mice are sacrificed 8 weeks after transplantation to obtain the tumor tissues. Expression of ELOVL2 in the xenografted tumor is examined by Western blot analysis (D) and immunohistochemical analysis (E). Three tumor sets are analyzed and the average protein expression is denoted in a bar graph. Representative images are shown. Scale bar, 50 μm.

Article Snippet: ELOVL2 ( {"type":"entrez-nucleotide","attrs":{"text":"NM_017770","term_id":"1519313823","term_text":"NM_017770"}} NM_017770 ) Human ORF Clone Lenti Particle (Cat. No. RC209232L4V) , , , , Origene.

Techniques: Expressing, Recombinant, Plasmid Preparation, Animal Model, Injection, Transplantation Assay, Western Blot, Immunohistochemical staining

Journal: American Journal of Cancer Research

Article Title: ELOVL2: a novel tumor suppressor attenuating tamoxifen resistance in breast cancer

doi:

Figure Lengend Snippet: ELOVL2 suppresses tumor growth and recovers Tam sensitivity in in vitro and in vivo animal model. A. Effect of ELOVL2 on Tam sensitivity is examined after treating the ELOVL2 ORF-transfected MCF-7/TamR cells with Tam and then measuring the growth rate by CCK assay. B. Effect of ELOVL2 on Tam sensitivity is examined by colony formation assay. All the assays are performed in triplicates, and the result is depicted as mean ± SE. Representative images are shown for the colony formation assay. NC, negative control vector. ORF, open reading frame. C. MCF-7/TamR cells that are stably transfected with ELOVL2-expressing cDNA or control DNA are subcutaneously injected into nude mice and Tam is administered 3 weeks after cell injection. The tumor volume is measured for 7 weeks. D. At week 8, mice are sacrificed to obtain the tumor tissues (n = 6 for corn oil-treated mice; n = 4 for Tam-treated mice).

Article Snippet: ELOVL2 ( {"type":"entrez-nucleotide","attrs":{"text":"NM_017770","term_id":"1519313823","term_text":"NM_017770"}} NM_017770 ) Human ORF Clone Lenti Particle (Cat. No. RC209232L4V) , , , , Origene.

Techniques: In Vitro, In Vivo, Animal Model, Transfection, Colony Assay, Negative Control, Plasmid Preparation, Stable Transfection, Expressing, Injection

Journal: American Journal of Cancer Research

Article Title: ELOVL2: a novel tumor suppressor attenuating tamoxifen resistance in breast cancer

doi:

Figure Lengend Snippet: Highest confidence network of genes displaying altered ELOVL2 expression in MCF-7/TamR. ELOVL2 is overexpressed in MCF-7/TamR and a genome-wide expression analysis is performed. (A) Heatmap analysis of 969 genes that are significantly deregulated by ELOVL2. The data are from the microarray in duplicates. (B) Highest confidence network of genes displaying altered expression identifies “Cardiovascular Disease, Cell-To-Cell Signaling and Interaction, Inflammatory Response” pathway and “Behavior, Reproductive System Development and Function, Cardiac Infarction” pathway as the top networks. Genes that are upregulated are shaded in red, whereas those that are downregulated are shaded in green, with the color intensity signifying the magnitude of expression change. Solid lines representing direct interactions, and dashed lines representing indirect interactions. (C) Top 10 canonical pathways and (D) disease and function annotation of the genes of which expression is significantly altered by ELOVL2. The most significant canonical pathway is “Antigen Presentation Pathway” and disease and function annotation is “Solid tumor”.

Article Snippet: ELOVL2 ( {"type":"entrez-nucleotide","attrs":{"text":"NM_017770","term_id":"1519313823","term_text":"NM_017770"}} NM_017770 ) Human ORF Clone Lenti Particle (Cat. No. RC209232L4V) , , , , Origene.

Techniques: Expressing, Genome Wide, Microarray

Journal: American Journal of Cancer Research

Article Title: ELOVL2: a novel tumor suppressor attenuating tamoxifen resistance in breast cancer

doi:

Figure Lengend Snippet: ELOVL2 regulates genes in AKT and ERa networks. A few genes in the top IPA network (Figure 7B) are selected and qPCR is performed to confirm the microarray expression data. All genes show the same expression trend with being up- or down-regulated in ELOVL2 overexpression cells compared with the MCF-7/TamR cells, although the alteration level is not the same.

Article Snippet: ELOVL2 ( {"type":"entrez-nucleotide","attrs":{"text":"NM_017770","term_id":"1519313823","term_text":"NM_017770"}} NM_017770 ) Human ORF Clone Lenti Particle (Cat. No. RC209232L4V) , , , , Origene.

Techniques: Microarray, Expressing, Over Expression

Journal: American Journal of Cancer Research

Article Title: ELOVL2: a novel tumor suppressor attenuating tamoxifen resistance in breast cancer

doi:

Figure Lengend Snippet: THEM4 is downregulated by ELOVL2 and increases Tam resistance. (A) Increased expression of THEM4 in MCF-7/TamR cells. qPCR (left) and Western blot analysis (right) are performed in MCF-7/TamR and MCF-7 cells. (B) Downregulation of THEM4 by ELOVL2 in MCF-7/TamR cells, determined by qPCR. ELOVL2 ORF: cells stably transfected with ELOVL2 cDNA; ORF NC; negative cDNA control. (C) Increased expression of THEM4 in the xenografted MCF-7/TamR but suppression by ELOVL2. Western blot analysis is performed for tumor tissues from ELOVL2 ORF and control. Immunohistochemical analysis of THEM4 in xenografted tumor tissue of MCF-7/TamR (D) and cells stably transfected with ELOVL2 cDNA (E) Scale bar, 50 μm. Effect of THEM4 on recovery of Tam sensitivity. THEM4 is downregulated via siRNA #2 at a final concentration of 40 nM in MCF-7/TamR (F) and ELOVL2-overexpressing MCF-7/TamR cells (G). Sensitivity to Tam is examined by colony formation assay. Representative images from three independent assays are shown. (H) Effect of THEM4 on cell proliferation is examined by a dye-based CCK assay. (I) Effect of THEM4 on TamR is examined by exposing the cells to Tam after downregulating the gene with siRNA. All the assays are performed in triplicates, and the result is depicted as mean ± SE.

Article Snippet: ELOVL2 ( {"type":"entrez-nucleotide","attrs":{"text":"NM_017770","term_id":"1519313823","term_text":"NM_017770"}} NM_017770 ) Human ORF Clone Lenti Particle (Cat. No. RC209232L4V) , , , , Origene.

Techniques: Expressing, Western Blot, Stable Transfection, Transfection, Immunohistochemical staining, Concentration Assay, Colony Assay

Journal: American Journal of Cancer Research

Article Title: ELOVL2: a novel tumor suppressor attenuating tamoxifen resistance in breast cancer

doi:

Figure Lengend Snippet: Schematic illustration of the regulatory pathway by ELOVL2. The uptake ratio of Tam across plasma membrane in MCF-7/TamR cells is similar to that in the parental MCF-7 cells. ERa and ELOVL2 crosstalk to regulate each other. ELOVL2 blocks the PI3K/AKT/mTOR pathway via inhibiting THEM4 and PI3K. In TamR cancer, ELOVL2 is downregulated by hypermethylation, resulting in loss of inactivation of AKT and also downstream genes such as CREB and mTOR, or activation of downstream genes such as BMF, eventually leading to Tam resistance and increased cell proliferation.

Article Snippet: ELOVL2 ( {"type":"entrez-nucleotide","attrs":{"text":"NM_017770","term_id":"1519313823","term_text":"NM_017770"}} NM_017770 ) Human ORF Clone Lenti Particle (Cat. No. RC209232L4V) , , , , Origene.

Techniques: Activation Assay

Journal: American Journal of Cancer Research

Article Title: ELOVL2: a novel tumor suppressor attenuating tamoxifen resistance in breast cancer

doi:

Figure Lengend Snippet: ELOVL2 downregulates total amount of AKT and p-AKT. A. Downregulation of genes in the AKT pathway by ELOVL2. qPCR is performed for seven genes in the AKT pathway in the ELOVL2-overexpressing MCF-7/TamR cells. Samples are analyzed in triplicates, and the result is shown as mean ± SE. B. Protein level of AKT and p-AKT is analyzed in the MCF-7/TamR cells transiently transfected with a recombinant ELOVL2 cDNA plasmid. Western blot analysis is performed in triplicates, and a representative image is shown with a bar graph depicted as mean ± SE.

Article Snippet: ELOVL2 ( {"type":"entrez-nucleotide","attrs":{"text":"NM_017770","term_id":"1519313823","term_text":"NM_017770"}} NM_017770 ) Human ORF Clone Lenti Particle (Cat. No. RC209232L4V) , , , , Origene.

Techniques: Transfection, Recombinant, Plasmid Preparation, Western Blot

Journal: Oncogene

Article Title: The DACH1 gene is frequently deleted in prostate cancer, restrains prostatic intraepithelial neoplasia, decreases DNA damage repair, and predicts therapy responses.

doi: 10.1038/s41388-023-02668-9

Figure Lengend Snippet: Fig. 2 DACH1 deletion PCa enhances AR signaling. A Interrogation of human PCa gene expression data [26], showing candidate genetic drivers ERG, ETV1/ETV4/FLI1, SPOP, FOXA1, and unknown. Samples with DACH1 homozygous (deep) genetic deletions (29/333) are shown as an additional subtype. The AR score (the average of the AR target gene expression) refers to a group of AR-responsive genes [26], and together with the expression Z-score of the AR target genes, are shown as colorimetric scales. The AR score-based gene names are shown. The androgen receptor (AR) activity, inferred by the induction of AR target genes, was increased in DACH1 homozygous (‘deep’) deletion PCa compared with normal (P = 2 × 10−5 by t-test) and ERG mutation groups (P = 0.003 by t-test). B AR mRNA and AR protein levels, shown for each DACH1 deletion sample, were not significantly different. C The iCluster [29], mRNA cluster, and SCNA (somatic copy-number alteration), and DNA methylation status are shown for the PCa classified by the corresponding gene deletion subtypes. D DACH1 homozygous deletions were enriched for iCluster 2 and 3 [29], mRNA cluster 2 (P = 0.0003 by Fisher exact test, SCNA (“more” somatic copy-number alteration, P = 0.0004 by Fisher exact test), but not for DNA methylation.

Article Snippet: For detection of DACH1 protein, antigen retrieval was done in Tris/EDTA buffer at pH 9 for 30min at 97 °C, followed by 30min incubation with rabbit polyclonal DACH1 antibody (Cat. #10914-1-AP, Proteintech, Rosemont, IL; dilution 1:1,000) [33], HRP-conjugated polymer (Envision FLEX, Cat#GV80011-2, Agilent), and DAB chromogen deposition.

Techniques: Gene Expression, Targeted Gene Expression, Expressing, Activity Assay, Mutagenesis, DNA Methylation Assay

Journal: Oncogene

Article Title: The DACH1 gene is frequently deleted in prostate cancer, restrains prostatic intraepithelial neoplasia, decreases DNA damage repair, and predicts therapy responses.

doi: 10.1038/s41388-023-02668-9

Figure Lengend Snippet: Fig. 3 Prostate-specific Dach1 gene deletion promotes prostate hyperplasia and dysplasia in OncoMice (15 weeks). A Schematic representation of transgenes integrated into mice. B Representative immunohistochemistry for Dach1, with data quantitated as mean ± standard error of the mean (SEM) for N = 20 (4 separate mice, with 5 views per mouse, in each group). C Blinded quantitative histology grading of prostate of multigenic mice at 15 weeks. Data are shown as mean ± SEM for N = 15 (5 separate mice, with 3 prostate areas [anterior, ventral, lateral] per mouse) in each group). H&E staining demonstrates the presence of a focal atypical intraductal proliferation in Dach1−/−prostate, compatible with prostatic intraepithelial neoplasia (PIN). Representative immunohistochemistry with results shown as mean ± SEM for Ki-67 (n = 20, 4 separate mice for each genotype, 5 views per mouse) (D), Beclin 1 (n = 9, 3 separate mice for each genotype, 3 views per mouse) (E); and AR (n = 15 for Dach1wt/wt mice, 3 separate mice, 5 views per mouse) (n = 12 for Dach1fl/flmice, 3 separate mice, 2 views for one mouse and 5 views for other two mice) (F). Scale bars, 50 μm. A Student’s t test was performed for all comparisons.

Article Snippet: For detection of DACH1 protein, antigen retrieval was done in Tris/EDTA buffer at pH 9 for 30min at 97 °C, followed by 30min incubation with rabbit polyclonal DACH1 antibody (Cat. #10914-1-AP, Proteintech, Rosemont, IL; dilution 1:1,000) [33], HRP-conjugated polymer (Envision FLEX, Cat#GV80011-2, Agilent), and DAB chromogen deposition.

Techniques: Immunohistochemistry, Staining

Journal: Oncogene

Article Title: The DACH1 gene is frequently deleted in prostate cancer, restrains prostatic intraepithelial neoplasia, decreases DNA damage repair, and predicts therapy responses.

doi: 10.1038/s41388-023-02668-9

Figure Lengend Snippet: Fig. 4 Prostate-specific Dach1 gene deletion in TRAMP mice induces PIN lesions with increased TGFβ activity. Genome-wide expression analysis of TRAMP Dach1+/+ vs. Dach1−/−PIN lesions was analyzed for enrichment of known targets of upstream regulators using Ingenuity Pathway Analysis (IPA) and represented as (A) barplot was calculated by IPA activation Z-score labeled and as (B) bubble plot with size of the bubbles proportional to –log10 p values. C IHC was conducted for SMAD activation using SMAD2P, quantitated and shown as (D) mean ± SEM (n = 15 for Dach1wt/wt mice, 3 separate mice, 5 views per mouse) (n = 10 for Dach1fl/flmice, 2 separate mice, 5 views per mouse). E–G Western blot of either PCa cell lines for the presence of DACH1 (E, F) or (G) TGFβ-treated (10 ng/ml for 24 h) PC3 cells illustrating induction of nuclear vimentin and cytoplasmic cyclin D1. Protein loading controls are β-tubulin (a marker of cytoplasmic proteins) and Lamin B1 (a marker for nuclear protein enrichment). H Microarray-based gene expression analysis of PC3 cells stably expressing DACH1, showing restraint of genes mediating TGFβ signaling (shown with blue arrows), including reduction of TGFB2 and TGFBR2 [33].

Article Snippet: For detection of DACH1 protein, antigen retrieval was done in Tris/EDTA buffer at pH 9 for 30min at 97 °C, followed by 30min incubation with rabbit polyclonal DACH1 antibody (Cat. #10914-1-AP, Proteintech, Rosemont, IL; dilution 1:1,000) [33], HRP-conjugated polymer (Envision FLEX, Cat#GV80011-2, Agilent), and DAB chromogen deposition.

Techniques: Activity Assay, Genome Wide, Expressing, Activation Assay, Labeling, Western Blot, Marker, Protein Enrichment, Microarray, Gene Expression, Stable Transfection

Journal: Oncogene

Article Title: The DACH1 gene is frequently deleted in prostate cancer, restrains prostatic intraepithelial neoplasia, decreases DNA damage repair, and predicts therapy responses.

doi: 10.1038/s41388-023-02668-9

Figure Lengend Snippet: Fig. 6 DACH1 facilitates the recruitment of, and co-accumulates with, Ku70/Ku80 proteins at sites of DNA damage. A Co-accumulation of Ku-70/Ku-80 at laser micro irradiation-induced DSBs sites in Dach1+/+ 3T3 cells. B, C 24 h after transfection, the accumulation of DACH1 and Ku70/Ku80 in Dach1−/−3T3 cells transfected with EGFP or EGFP-tagged DACH1 and red fluorescent protein (RFP)-tagged Ku70 or RFP-tagged Ku80 expression vectors were treated with laser micro-irradiation (403 nm) to induce DSBs. Time is shown after micro-irradiation. Accumulation of the transfected proteins was indicated by EGFP (green) or RFP (red) fluorescence at laser-irradiated sites. Co-accumulation was visualized in yellow merged images. Time is shown in minutes and -fold increase in foci intensity is shown as mean ± SEM for N = 5 separate cells.

Article Snippet: For detection of DACH1 protein, antigen retrieval was done in Tris/EDTA buffer at pH 9 for 30min at 97 °C, followed by 30min incubation with rabbit polyclonal DACH1 antibody (Cat. #10914-1-AP, Proteintech, Rosemont, IL; dilution 1:1,000) [33], HRP-conjugated polymer (Envision FLEX, Cat#GV80011-2, Agilent), and DAB chromogen deposition.

Techniques: Irradiation, Transfection, Expressing

Journal: Molecular Oncology

Article Title: Hypoxia‐induced alterations of G2 checkpoint regulators

doi: 10.1016/j.molonc.2015.12.015

Figure Lengend Snippet: Hypoxia‐induced alterations in mRNA and protein expression of G2 checkpoint regulators. A. Gene expression of positive G2 checkpoint regulators in U2OS cells. The ratio of mRNA expression in cells treated with hypoxia (0.2% O2, 24 h) relative to mRNA expression in cells cultured at normoxia (21% O2) is shown. Data were obtained from genome wide microarray analysis. The positive G2 checkpoint regulators were found from published studies as described in Table 1. B. Gene expression of negative G2 checkpoint regulators similar as in A. C. Immunoblot analysis of protein extracts from U2OS cells exposed to hypoxia or normoxia for 24 h. The samples are from the same experiment as the microarray results shown in A and B. HIF1α was shown to confirm hypoxia. H4 was used as loading control.

Article Snippet: Human U2OS osteosarcoma, HeLa cervical carcinoma cells and NCI–H460 lung cancer cells (ATCC) were cultured in DMEM (Dulbecco's modified Eagle's) medium (Invitrogen) supplemented with 10% fetal bovine serum (FBS) and 1% Penicillin/Streptomycin (P/S) at 37 °C in a humidified atmosphere with 5% CO 2 .

Techniques: Expressing, Gene Expression, Cell Culture, Genome Wide, Microarray, Western Blot, Control

Journal: Molecular Oncology

Article Title: Hypoxia‐induced alterations of G2 checkpoint regulators

doi: 10.1016/j.molonc.2015.12.015

Figure Lengend Snippet: Protein levels of G2 checkpoint regulators in individual G2 cells following hypoxia. A. Cell cycle profiles of U2OS cells after hypoxia treatment as in Figure 1 (24 h 0.2% O2). Flow cytometric analysis was performed after staining with anti phospho‐H3Ser10 (H3P) to mark mitotic cells, and the DNA stain Hoechst. Numbers indicate fraction of mitotic cells. B. Flow cytometric barcoding analysis for accurate measurement of protein levels in G2 phase cells. U2OS cells treated with four different conditions, as indicated in the right column, were labeled with different concentrations of Pacific Blue and combined into a single sample. The single sample of cells was then stained with antibodies to Cyclin B and phospho‐H3 and with the DNA‐stain FxCycle Far Red, and analyzed by flow cytometry. Gating of the Pacific Blue‐SSC plot (left) was used to separate the four original samples. The G1, S, G2 and M cell cycle phase populations were gated from the scatter plot of phospho‐Histone H3(Ser10) (H3P) versus DNA content, and the median signal for Cyclin B levels in each cell cycle phase could thus be obtained. C.Median values of G2 phase levels of the indicated proteins obtained as in B, after subtraction of background values obtained as in Figure S1. U2OS cells were grown at 21% O2, or exposed to 24 h hypoxia at 0.2% O2, or first exposed to 0.2% O2 for 24 h followed by subsequent incubation at 21% O2 for 90 min (90 min reox) or 6 h (6 h reox). Average results from at least 3 independent experiments are shown. Error bars indicate SEM.

Article Snippet: Human U2OS osteosarcoma, HeLa cervical carcinoma cells and NCI–H460 lung cancer cells (ATCC) were cultured in DMEM (Dulbecco's modified Eagle's) medium (Invitrogen) supplemented with 10% fetal bovine serum (FBS) and 1% Penicillin/Streptomycin (P/S) at 37 °C in a humidified atmosphere with 5% CO 2 .

Techniques: Staining, Labeling, Flow Cytometry, Incubation

Journal: Molecular Oncology

Article Title: Hypoxia‐induced alterations of G2 checkpoint regulators

doi: 10.1016/j.molonc.2015.12.015

Figure Lengend Snippet: Hypoxia‐induced changes in CDK activity and G2 checkpoint activation. A. CDK activity in G2 phase cells as measured by phosphorylation of BRCA2‐Ser3291. U2OS cells were grown at 21% O2, or incubated at 0.2% O2 for 24 h and harvested inside the hypoxia chamber and at 1 and 4 h after reoxygenation, or treated with Roscovitine for 2 h at 21% O2. Flow cytometry barcoding analysis of phospho‐BRCA2‐Ser3291 was performed as in Figure 2 and S2. B. Immunoblot analysis of U2OS cells treated as in A with antibodies to total BRCA2 and γ‐tubulin (loading control). C. G2 checkpoint activation after IR (0.2%O2 24 h). Flow cytometric analysis of G2 checkpoint arrest after X‐ray irradiation (0, 0.5, 1 Gy) of normoxic U2OS cells (21%O2) or U2OS cells exposed to 24 h of hypoxia at 0.2%O2 and irradiated 15 min after reoxygenation. Nocodazole was added to all samples 1 h after IR, and the samples were harvested 5 h later. The relative mitotic fraction was determined as the fraction of phospho‐H3 positive cells in irradiated samples divided by the fraction of phospho‐H3 positive cells in non‐irradiated samples. Average values from 3 independent experiments are shown. Error bars indicate SEM. D. Phosphorylation of BRCA2‐Ser3291 in H460 cells treated with hypoxia and analyzed as in A. E. G2 checkpoint activation in H460 cells treated with hypoxia and IR and analyzed as in C.

Article Snippet: Human U2OS osteosarcoma, HeLa cervical carcinoma cells and NCI–H460 lung cancer cells (ATCC) were cultured in DMEM (Dulbecco's modified Eagle's) medium (Invitrogen) supplemented with 10% fetal bovine serum (FBS) and 1% Penicillin/Streptomycin (P/S) at 37 °C in a humidified atmosphere with 5% CO 2 .

Techniques: Activity Assay, Activation Assay, Phospho-proteomics, Incubation, Flow Cytometry, Western Blot, Control, Irradiation

Journal: Molecular Oncology

Article Title: Hypoxia‐induced alterations of G2 checkpoint regulators

doi: 10.1016/j.molonc.2015.12.015

Figure Lengend Snippet: IR‐induced G2 checkpoint and expression of G2 checkpoint regulators in U2OS cells after severe hypoxia (∼0.03% O2 20 h) and prolonged mild hypoxia (0.2%O2, 72 h). A. Similar G2 checkpoint measurement after IR as in Figure 3C following incubation at severe hypoxia (∼0.03% O2 20 h). B. Similar as in A following incubation at prolonged mild hypoxia (0.2% O2 72 h). C. Similar flow cytometric barcoding analysis of protein levels in G2 phase cells as in Figure 2C following incubation at severe hypoxia (∼0.03% O2 20 h). D. Similar as in C following incubation at 0.2% O2, 72 h.

Article Snippet: Human U2OS osteosarcoma, HeLa cervical carcinoma cells and NCI–H460 lung cancer cells (ATCC) were cultured in DMEM (Dulbecco's modified Eagle's) medium (Invitrogen) supplemented with 10% fetal bovine serum (FBS) and 1% Penicillin/Streptomycin (P/S) at 37 °C in a humidified atmosphere with 5% CO 2 .

Techniques: Expressing, Incubation

Journal: Cancers

Article Title: Folic Acid Treatment Directly Influences the Genetic and Epigenetic Regulation along with the Associated Cellular Maintenance Processes of HT-29 and SW480 Colorectal Cancer Cell Lines

doi: 10.3390/cancers14071820

Figure Lengend Snippet: ( a ) Cell proliferation and ( b ) cell viability alterations of HT-29 and SW480 colorectal cancer cell lines following different folic acid (FA) supplies. Sulforhodamine B (SRB) was used for cell proliferation detection (* p ≤ 0.05, *** p ≤ 0.001), while cell viability data were obtained by alamarBlue assay (** p ≤ 0.01). FA-depleted cells were kept in media containing 0 ng/mL FA, whereas treated cells were exposed to 100 and 10,000 ng/mL FA for 72 h. The percentages of cell proliferation and viability were given relative to samples kept in the normal growth media. FA: folic acid.

Article Snippet: HT-29 (ATCC HTB-39) and SW480 (ATCC CCL-228) human colon adenocarcinoma cell lines were cultured in RPMI 1640 medium (LM-R1641, Biosera, Ringmer, UK) containing 10% fetal bovine serum (Biosera), 80 mg/2 mL gentamycin (Sandoz GmbH, Kundl, Austria), and 2 mM L-glutamine (Biosera).

Techniques: Alamar Blue Assay

Journal: Cancers

Article Title: Folic Acid Treatment Directly Influences the Genetic and Epigenetic Regulation along with the Associated Cellular Maintenance Processes of HT-29 and SW480 Colorectal Cancer Cell Lines

doi: 10.3390/cancers14071820

Figure Lengend Snippet: Genomic stability detection of HT-29 and SW480 cells exposed to different folic acid (FA) concentrations (0, 100, 10,000 ng/mL). ( a ) Micronucleus (MN) scoring was performed on DAPI- and anti-γ-H2AX-stained slides. Left: We obtained the results by proportioning the cells with MN with all cells counted (** p ≤ 0.01, *** p ≤ 0.001). Right: Representative γ-H2AX-positive micronuclei are indicated with arrows. ( b ) DNA integrity was evaluated with comet assay, additionally. Left: Graphs show the changes in genomic stability in consideration of comet tail DNA percentage (* p ≤ 0.05). Right: Characteristic comets of both cell lines were captured following different treatments. FA: folic acid.

Article Snippet: HT-29 (ATCC HTB-39) and SW480 (ATCC CCL-228) human colon adenocarcinoma cell lines were cultured in RPMI 1640 medium (LM-R1641, Biosera, Ringmer, UK) containing 10% fetal bovine serum (Biosera), 80 mg/2 mL gentamycin (Sandoz GmbH, Kundl, Austria), and 2 mM L-glutamine (Biosera).

Techniques: Staining, Single Cell Gel Electrophoresis

Journal: Cancers

Article Title: Folic Acid Treatment Directly Influences the Genetic and Epigenetic Regulation along with the Associated Cellular Maintenance Processes of HT-29 and SW480 Colorectal Cancer Cell Lines

doi: 10.3390/cancers14071820

Figure Lengend Snippet: DNA methylation analysis of HT-29 and SW480 cell lines exposed to different folic acid (FA) concentrations. The methylation levels of long interspersed nuclear element 1 (LINE-1) CpG positions (pos 1, pos 2, pos 3) were ( a ) summarized and also ( b ) visualized individually to detect global DNA methylation changes. With the use of Reduced Representation Bisulfite Sequencing (RRBS) method, a genome-wide methylome profile of 10,000 ng/mL FA-treated cells was established in the comparison of cells kept in FA-free (0 ng/mL FA) media. ( c ) Firstly, the number of genes with altered methylation in the investigated CpG sites was assessed. “Hyper” and “hypo” sections indicate the number of genes with methylated and unmethylated CpG sites, respectively. The intersection of these two categories refers to the genes that possess both methylated and unmethylated CpG dinucleotides. ( d ) Heatmap shows the top 10 significantly ( p ≤ 0.05) enriched Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways with the number of differentially methylated genes. ( e ) Pie charts represent the localization of differentially methylated sites (DMS) in distinct chromatin states. FA: folic acid; pos: CpG position; hyper: hypermethylation; hypo: hypomethylation; DMSs: differentially methylated sites; heterochrom/lo: heterochromatin or low signal region; txn: transcription; CNV: copy number variation; KEGG: Kyoto Encyclopedia of Genes and Genomes.

Article Snippet: HT-29 (ATCC HTB-39) and SW480 (ATCC CCL-228) human colon adenocarcinoma cell lines were cultured in RPMI 1640 medium (LM-R1641, Biosera, Ringmer, UK) containing 10% fetal bovine serum (Biosera), 80 mg/2 mL gentamycin (Sandoz GmbH, Kundl, Austria), and 2 mM L-glutamine (Biosera).

Techniques: DNA Methylation Assay, Methylation, Methylation Sequencing, Genome Wide, Comparison

Journal: Cancers

Article Title: Folic Acid Treatment Directly Influences the Genetic and Epigenetic Regulation along with the Associated Cellular Maintenance Processes of HT-29 and SW480 Colorectal Cancer Cell Lines

doi: 10.3390/cancers14071820

Figure Lengend Snippet: Genome-wide transcriptome alterations of HT-29 and SW480 cells following 10,000 ng/mL folic acid (FA) supplementation detected by Human Transcriptome Array 2.0 (HTA 2.0). ( a ) Pie charts represent the proportion of up- and downregulated genes. ( b ) Visual networks of protein–protein interactions were generated by the StringApp of Cytoscape software based on the list of genes with significant ( p ≤ 0.05) expression alterations and ≥|1.5| fold change (FC). Colors refer to the expression level of protein-coding genes (dark blue: FC ≤ −2, light blue: FC ≥ −2 and ≤−1.5, light red: FC ≥ 1.5 and ≤2, dark red: FC ≥ 2). ( c ) Top 10 genes showing significant ( p ≤ 0.05) up- and downregulation visualized with volcano plots. Gray points represent all the transcripts detected by HTA 2.0 microarray, while significantly ( p ≤ 0.05) altering genes with FC ≥ |1.5| value were marked with red and blue. P-val: p -value.

Article Snippet: HT-29 (ATCC HTB-39) and SW480 (ATCC CCL-228) human colon adenocarcinoma cell lines were cultured in RPMI 1640 medium (LM-R1641, Biosera, Ringmer, UK) containing 10% fetal bovine serum (Biosera), 80 mg/2 mL gentamycin (Sandoz GmbH, Kundl, Austria), and 2 mM L-glutamine (Biosera).

Techniques: Genome Wide, Protein-Protein interactions, Generated, Software, Expressing, Microarray

Journal: Cancers

Article Title: Folic Acid Treatment Directly Influences the Genetic and Epigenetic Regulation along with the Associated Cellular Maintenance Processes of HT-29 and SW480 Colorectal Cancer Cell Lines

doi: 10.3390/cancers14071820

Figure Lengend Snippet: The intersection of genome-wide DNA methylation and gene expression data obtained by Reduced Representation Bisulfite Sequencing (RRBS) and Human Transcriptome Array (HTA) 2.0 analyses. Values represent the methylome and transcriptome pattern changes of 10,000 ng/mL folic acid (FA)-treated HT-29 and SW480 cells compared to non-treated samples (0 ng/mL FA). Only genes with promoter methylation status alteration in accordance with their expression level ( p ≤ 0.05 and fold change ≥|1.5|) were listed (left) and also visualized in volcano plots (right). Gray points represent all the transcripts detected by the microarray, while blue ones highlight down- and red ones show upregulating genes from the list. met. status: DNA methylation status; met. diff.: DNA methylation difference; expr. status: gene expression status; P-val: p -value.

Article Snippet: HT-29 (ATCC HTB-39) and SW480 (ATCC CCL-228) human colon adenocarcinoma cell lines were cultured in RPMI 1640 medium (LM-R1641, Biosera, Ringmer, UK) containing 10% fetal bovine serum (Biosera), 80 mg/2 mL gentamycin (Sandoz GmbH, Kundl, Austria), and 2 mM L-glutamine (Biosera).

Techniques: Genome Wide, DNA Methylation Assay, Gene Expression, Methylation Sequencing, Methylation, Expressing, Microarray

Journal: iScience

Article Title: cGMP signaling pathway that modulates NF-κB activation in innate immune responses

doi: 10.1016/j.isci.2021.103473

Figure Lengend Snippet: Membrane-bound cGMP-dependent protein kinase, PRKG2, and protein phosphatase 2A are involved in modulating NF-κB activation in human cells (A) Membrane-bound cGK, PRKG2, enhances MyD88-dependent activation of NF-κB in human HEK293 cells. (B) Effects of kinase-defective PRKG2 mutant, D576N, and cGMP binding-domain PRKG2 mutant, ΔCBD, on MyD88-dependent NF-κB activation. (C) Effects of co-expression of PRKG2 on IRAK1-dependent NF-κB activation and on TRIF-dependent NF-κB activation in human HEK293 cells. (D) Effects of siRNA-mediated targeting of human protein phosphatase 2A (PP2A) subunit, PPP2-R2B, IRAK1, and MyD88 on the enhanced IRAK1-dependent NF-κB activation by PRKG2. Two different siRNAs targeting PPP2-R2B (7 and 8) were used. (E and F) Effects of co-expression of PRKG2 on the modification and phosphorylation (pS376, (F) of IRAK1 in human HEK293 cells. (G) Effects of siRNA-mediated targeting of human PP2A subunit, PP2-R2B, on the enhanced modification of IRAK1 by PRKG2. ∗ P < 0.05, ns P > 0.1, Student's t test. Data are represented as mean, and error bars indicate standard deviation. Data shown are representative of at least three independent experiments.

Article Snippet: Human, HEK293 cells , ATCC , CRL-1573.

Techniques: Membrane, Activation Assay, Mutagenesis, Binding Assay, Expressing, Modification, Phospho-proteomics, Standard Deviation

Journal: iScience

Article Title: cGMP signaling pathway that modulates NF-κB activation in innate immune responses

doi: 10.1016/j.isci.2021.103473

Figure Lengend Snippet:

Article Snippet: Human, HEK293 cells , ATCC , CRL-1573.

Techniques: Virus, Recombinant, Luciferase, SYBR Green Assay, Microarray, Genome Wide

Journal:

Article Title: Integrative genomics identifies molecular alterations that challenge the linear model of melanoma progression

doi: 10.1158/0008-5472.CAN-10-2958

Figure Lengend Snippet: A) SNP array in the region of MTAP shows that primary immortalized melanocyte Hermes 2B (control, black) and primary nodular melanoma cell lines (pink) have 2 copies of MTAP. There is a heterozygous deletion in SSM cell line WM35 (blue) spanning exons 1–4 and a homozygous deletion in exons 5–8. The deletion in WM1552c is homozygous and encompasses all exons. B) Genomic PCR of the MTAP gene in SSM cell line WM1552c confirms genomic losses in exons 1, 5, and 8, consistent with the large area of genomic deletion noted on SNP array. In SSM cell line WM35 (blue), only exons 5 and 8 are homozygously deleted which verifies the focal genomic loss detected using the SNP array. C) qRT-PCR verification of differential mRNA expression between NM (WM278, WM39, Lu451, SK-MEL-147) and SSM (WM1552c, WM35) cell lines in MTAP. D) Ectopic expression of MTAP in SSM cell line WM1552c by lentiviral infection (inset) results in decreased growth relative to control MTAP null cells. Mean ± SD, N=3. *P<0.05, **P<0.01, n.s.-not significant (relative to normal human genomic DNA in B).

Article Snippet: SNP DNA array DNA was hybridized to the Affymetrix Genome-Wide Human SNP 6.0 Array as per the manufacturer protocol (Affymetrix Santa Clara, CA).

Techniques: Control, Quantitative RT-PCR, Expressing, Infection

Journal: Cell

Article Title: Gene Essentiality Profiling Reveals Gene Networks and Synthetic Lethal Interactions with Oncogenic Ras

doi: 10.1016/j.cell.2017.01.013

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Human GM-CSF , Miltenyi Biotec , 130-093-862.

Techniques: Recombinant, Transfection, Adhesive, Sequencing, Cell Viability Assay, Microarray, Expressing, Genome Wide, Illumina Sequencing, CRISPR, Plasmid Preparation, Software

Journal: International Journal of Molecular Sciences

Article Title: Contribution of −Omics Technologies in the Study of Porphyromonas gingivalis during Periodontitis Pathogenesis: A Minireview

doi: 10.3390/ijms24010620

Figure Lengend Snippet: Periodontitis pathogenesis and P. gingivalis overview. ( A ) During the onset and progression of periodontitis, P. gingivalis resides in the subgingival biofilm adhered to the tooth surface, where it interacts metabolically with other bacteria, inducing them to express different virulence factors with pathogenic potential. In parallel, P. gingivalis acts as a keystone pathogen, altering the regulation of the immune response in the susceptible host. The metabolic synergism and immune response subversion provide the nutritional and protective conditions required by the dysbiotic subgingival community to increase their diversity and abundance, with the concomitant induction of a strong, destructive inflammatory response. Together, all these activities cause irreversible connective tissue breakdown and resorption of the tooth-supporting alveolar bone, the critical hallmark of periodontitis that causes tooth loss. ( B ) To invade the periodontium, P. gingivalis uses various virulence factors that allow it to colonize, replicate, and spread in different subsets of cells to increase its progeny and generate infection. ( C ) In addition to causing tooth loss, P. gingivalis -induced periodontitis can also affect systemic health, influencing the course of other diseases and conditions. This figure was created using BioRender.com.

Article Snippet: Transcriptomics , Sequencing of cultured P. gingivalis (WT, ATCC ® 33277TM and isogenic ∆luxS strain). , Validation of the role of LuxS in regulating hemin uptake and microcolony formation with other bacteria. Both activities related to quorum sensing. , [ ] .

Techniques: Metabolic Labelling, Bacteria, Infection

Journal: International Journal of Molecular Sciences

Article Title: Contribution of −Omics Technologies in the Study of Porphyromonas gingivalis during Periodontitis Pathogenesis: A Minireview

doi: 10.3390/ijms24010620

Figure Lengend Snippet: Workflow for −omic research focused on P. gingivalis studies. Samples from subgingival plaque are used for metagenomic, metatranscriptomic, proteomic, and metabolomic analyses. Samples are processed in the data acquisition stage by using sequencing or microarray techniques for DNA and RNA, or by mass spectrometry, used to identify proteins and metabolites. Bioinformatic workflows involve quality control and several downstream analyses, such as data clustering or data classification. For example, in the case of sequencing-based procedures, the analyses start with nucleic acid extraction, purification, quality control, library preparation, and sequencing; raw data from sequencing is analyzed using bioinformatics approaches, depending on the target or strategy for sequencing, such as a marker-targeted amplicon (e.g., a region of the 16S rRNA gene) or a shotgun sequencing (for a whole metagenome). In the case of isolated genome sequencing, generated data can be used in comparative genomic analysis. Transcriptomics studies are directed to RNA samples, involving RNA extraction, isolation, and quality checking, before sequencing. Most transcriptome studies are focused on mRNAs, focusing on the identification of the upregulated and downregulated gene expression. The further analysis comprises the determination of the global expression profile, clustering profile, and community composition profile. This figure was created using BioRender.com.

Article Snippet: Transcriptomics , Sequencing of cultured P. gingivalis (WT, ATCC ® 33277TM and isogenic ∆luxS strain). , Validation of the role of LuxS in regulating hemin uptake and microcolony formation with other bacteria. Both activities related to quorum sensing. , [ ] .

Techniques: Sequencing, Microarray, Mass Spectrometry, Control, Extraction, Purification, Marker, Amplification, Shotgun Sequencing, Isolation, Generated, RNA Extraction, Gene Expression, Expressing

Journal: International Journal of Molecular Sciences

Article Title: Contribution of −Omics Technologies in the Study of Porphyromonas gingivalis during Periodontitis Pathogenesis: A Minireview

doi: 10.3390/ijms24010620

Figure Lengend Snippet: Summary of deep amplicon sequencing, comparative genomics and metagenomics research studies associated to this review.

Article Snippet: Transcriptomics , Sequencing of cultured P. gingivalis (WT, ATCC ® 33277TM and isogenic ∆luxS strain). , Validation of the role of LuxS in regulating hemin uptake and microcolony formation with other bacteria. Both activities related to quorum sensing. , [ ] .

Techniques: Amplification, Sequencing, Functional Assay, Microarray, Genome Wide, Comparison, In Vitro

Journal: International Journal of Molecular Sciences

Article Title: Contribution of −Omics Technologies in the Study of Porphyromonas gingivalis during Periodontitis Pathogenesis: A Minireview

doi: 10.3390/ijms24010620

Figure Lengend Snippet: Summary of Transcriptomics and metatranscriptomics research studies associated to this review.

Article Snippet: Transcriptomics , Sequencing of cultured P. gingivalis (WT, ATCC ® 33277TM and isogenic ∆luxS strain). , Validation of the role of LuxS in regulating hemin uptake and microcolony formation with other bacteria. Both activities related to quorum sensing. , [ ] .

Techniques: Comparison, Expressing, Cell Culture, Bacteria, Binding Assay, Membrane, Quantitative Proteomics, Microarray, Isolation, In Vitro, Sequencing, Infection, Biomarker Discovery, In Silico, Control, Plasmid Preparation, Gene Expression

Journal: International Journal of Molecular Sciences

Article Title: Contribution of −Omics Technologies in the Study of Porphyromonas gingivalis during Periodontitis Pathogenesis: A Minireview

doi: 10.3390/ijms24010620

Figure Lengend Snippet: Summary of metabolomics and proteomics research studies associated to this review.

Article Snippet: Transcriptomics , Sequencing of cultured P. gingivalis (WT, ATCC ® 33277TM and isogenic ∆luxS strain). , Validation of the role of LuxS in regulating hemin uptake and microcolony formation with other bacteria. Both activities related to quorum sensing. , [ ] .

Techniques: Cell Culture, Control, Mass Spectrometry, Membrane, Expressing, Mutagenesis, Binding Assay, Nuclear Magnetic Resonance, Comparison, Biomarker Discovery, Chromatography, Infection, RNA Extraction, Derivative Assay

Journal: eLife

Article Title: GCN2 eIF2 kinase promotes prostate cancer by maintaining amino acid homeostasis

doi: 10.7554/eLife.81083

Figure Lengend Snippet: ( A ) Expression of the indicated eIF2α kinase was reduced in LNCaP cells using gene-specific siRNAs. Two different siRNAs were used for knockdown of each eIF2α kinase and compared to scrambled siRNA control. Cell growth was measured in replicate wells ( N = 5) for up to 6 days and is plotted as fold change (mean ± standard deviation [SD]) relative to day 0. Statistical significance was determined using a two-way analysis of variance (ANOVA) as described in ; *p ≤ 0.05, ***p ≤ 0.001, ****p ≤ 0.0001. ( B ) LNCaP cells were transfected with two different siRNAs targeting GCN2 or a scramble siRNA control and cell lysates were prepared and immunoblotted for the indicated proteins. Molecular weight markers are shown in kilodaltons. The relative levels of p-eIF2α normalized to total eIF2α compared to scramble siRNA control are indicated. ( C ) Expression of GCN2 was knocked-down in LAPC-4, C4-2B, MR49F, 22Rv1, or PC-3 cells using two different siRNAs and compared to scrambled siRNA control. Cell growth was measured for up to 6 days in replicate wells ( N = 5) as described in A . Statistical significance was determined using a two-way ANOVA as described in ; ***p ≤ 0.001, ****p ≤ 0.0001. ( D ) LNCaP cells were treated with indicated concentrations of GCN2iB and cell growth was measured for up to 6 days in replicate wells ( N = 5) as described in A . Statistical significance was determined using a two-way ANOVA as described in ; ****p ≤0.0001. ( E ) LNCaP cells were treated with GCN2iB (2 µM) or DMSO control for 24 hr and protein lysates were analyzed by immunoblot using antibodies that recognize total or phosphorylated GCN2-T899, total or phosphorylated eIF2α−S51, ATF4, or actin as indicated. Relative levels of p-eIF2α normalized to total eIF2α are shown. ( F ) Levels of p-GCN2 were measured in prostate tumor microarrays (Biomax PR1921b and PR807c) using immunohistochemistry (IHC). Staining for p-GCN2-T899 from non-malignant ( N = 33) and malignant PCa tissue ( N = 88) from patients >50 years old was analyzed and quantified using QuPath to determine the histoscore and is represented as a scatterplot. Statistical significance was determined using an unpaired two-tailed t -test; *p ≤ 0.05. Representative images showing p-GCN2-T899 staining of normal and malignant prostate tissues are shown. Scale bars shown are 200 µm (main image) and 20 µm (insert).

Article Snippet: GCN2 and ATF4 knockout cell lines were generated using CRISPR/Cas9 Human Gene Knockout Kits (Origene, Cat. #KN412459 and #KN402333) using hGCN2g1 (5′- AATTTAGTTTTGTACCCTCA -3′) and hATF4g1 (5′- CTTCCTGAGCAGCGAGGTGT -3′), respectively, following the manufacturer’s protocol.

Techniques: Expressing, Standard Deviation, Transfection, Molecular Weight, Western Blot, Immunohistochemistry, Two Tailed Test, Staining

Journal: eLife

Article Title: GCN2 eIF2 kinase promotes prostate cancer by maintaining amino acid homeostasis

doi: 10.7554/eLife.81083

Figure Lengend Snippet: ( A ) LNCaP cells were transfected with the indicated gene-specific siRNAs or a scramble control and the protein levels of HRI, PERK, or PKR and p-eIF2α, total eIF2α, and ATF4 were measured by immunoblot. Measurements of actin were used as a protein loading control in the immunoblot experiments. Molecular weight markers are shown in kilodaltons. ( B ) The indicated PCa cell lines were transfected with siRNAs targeting GCN2 or ATF4. Protein lysates were prepared and analyzed by immunoblot to determine the levels of GCN2, ATF4, or actin as indicated. ATF4 was not detected in the LAPC-4 cells.

Article Snippet: GCN2 and ATF4 knockout cell lines were generated using CRISPR/Cas9 Human Gene Knockout Kits (Origene, Cat. #KN412459 and #KN402333) using hGCN2g1 (5′- AATTTAGTTTTGTACCCTCA -3′) and hATF4g1 (5′- CTTCCTGAGCAGCGAGGTGT -3′), respectively, following the manufacturer’s protocol.

Techniques: Transfection, Western Blot, Molecular Weight

Journal: eLife

Article Title: GCN2 eIF2 kinase promotes prostate cancer by maintaining amino acid homeostasis

doi: 10.7554/eLife.81083

Figure Lengend Snippet: ( A ) Immunoblot analyses for 22Rv1, PC-3, and GCN2 KO clones. Protein lysates were analyzed by immunoblot to measure the levels of GCN2, ATF4, p-eIF2α, total eIF2α, or actin. Molecular weight markers are shown in kilodaltons. The relative levels of p-eIF2α normalized to total eIF2α compared to wild-type (WT) parental control are indicated. ( B ) Growth curve of 22Rv1 WT, 22Rv1 GCN2 KO (clone 7), or 22Rv1 GCN2 KO (clone 7) cells overexpressing GCN2. Data from replicate wells ( N = 5) are shown as fold change (mean ± standard deviation [SD]) relative to day 0. Statistical significance was determined using a two-way analysis of variance (ANOVA) as described in ; ****p ≤ 0.0001. ( C ) Protein lysates prepared from the 22Rv1 WT, 22Rv1 GCN2 KO (clone 7), or 22Rv1 GCN2 KO (clone 7) cells expressing GCN2 were analyzed by immunoblot for GCN2, ATF4, ASNS, or actin.

Article Snippet: GCN2 and ATF4 knockout cell lines were generated using CRISPR/Cas9 Human Gene Knockout Kits (Origene, Cat. #KN412459 and #KN402333) using hGCN2g1 (5′- AATTTAGTTTTGTACCCTCA -3′) and hATF4g1 (5′- CTTCCTGAGCAGCGAGGTGT -3′), respectively, following the manufacturer’s protocol.

Techniques: Western Blot, Clone Assay, Molecular Weight, Standard Deviation, Expressing

Journal: eLife

Article Title: GCN2 eIF2 kinase promotes prostate cancer by maintaining amino acid homeostasis

doi: 10.7554/eLife.81083

Figure Lengend Snippet: ( A ) C4-2B or 22Rv1 cells, cultured as indicated in the Materials and methods, or PC-3 cells cultured in HPLM media were treated with GCN2iB as indicated for up to 6 days. Cell growth was measured ( N = 5) and plotted as fold change (mean ± standard deviation [SD]) relative to day 0. Statistical significance was determined using a two-way analysis of variance (ANOVA) as described in ; ****p ≤ 0.0001. ( B ) 22Rv1 WT and 22Rv1 GCN2 KO (clone 7) cells were treated with GCN2iB as indicated for up to 6 days. Cell growth was measured ( N = 5) and plotted as fold change (mean ± SD) relative to day 0. Statistical significance was determined using a two-way ANOVA as described in ; ****p ≤ 0.0001. ( C ) Lysates were prepared from C4-2B, 22Rv1, or PC-3 cells treated with GCN2iB at the indicated concentrations or vehicle control (dimethyl sulfoxide, DMSO) for 48 hr and immunoblot analysis was carried out using antibodies that recognize p-GCN2-T899, total GCN2, p-eIF2α-S51, total eIF2α, ATF4, ASNS, TRIB3, LAT1 (SLC7A5), xCT (SLC7A11), 4F2 (SLC3A2) AR, or actin. Molecular weight markers are indicated in kilodaltons.

Article Snippet: GCN2 and ATF4 knockout cell lines were generated using CRISPR/Cas9 Human Gene Knockout Kits (Origene, Cat. #KN412459 and #KN402333) using hGCN2g1 (5′- AATTTAGTTTTGTACCCTCA -3′) and hATF4g1 (5′- CTTCCTGAGCAGCGAGGTGT -3′), respectively, following the manufacturer’s protocol.

Techniques: Cell Culture, Standard Deviation, Western Blot, Molecular Weight

Journal: eLife

Article Title: GCN2 eIF2 kinase promotes prostate cancer by maintaining amino acid homeostasis

doi: 10.7554/eLife.81083

Figure Lengend Snippet: ( A ) Lysates were prepared from BPH-1, LNCaP C4-2B, 22Rv1, or PC-3 cells and immunoblot analysis was carried out using antibodies that recognize p-GCN2-T899, total GCN2, p-eIF2α-S51, total eIF2α, ATF4, AR, or actin. Molecular weight markers are indicated in kilodaltons. ( B ) BPH-1 cells were transfected with siRNAs targeting GCN2, ATF4, or 4F2 (SLC3A2). Protein lysates were prepared and analyzed by immunoblot to determine the levels of GCN2, ATF4, 4F2 (SLC3A2), or actin as indicated. Molecular weight markers are indicated in kilodaltons. ( C ) Expression of GCN2, ATF4, or 4F2 (SLC3A2) was reduced in BPH-1 cells using two different gene-specific siRNAs as indicated and compared to a scramble siRNA control. Cell growth was measured for up to 6 days in replicate wells ( N = 5) as described in A . Statistical significance was determined using a two-way analysis of variance (ANOVA) as described in ; *p ≤ 0.05, **p ≤ 0.01. ( D ) Lysates were prepared from BPH-1 cells treated with GCN2iB at the indicated concentrations or vehicle control (DMSO) for 48 hr and immunoblot analysis was carried out using antibodies that recognize p-GCN2-T899, total GCN2, p-eIF2α-S51, total eIF2α, ATF4, ASNS, TRIB3, LAT1 (SLC7A5), xCT (SLC7A11), 4F2 (SLC3A2), AR, or actin. Molecular weight markers are indicated in kilodaltons. ( E ) BPH-1 cells were treated with 0.5–10 µM GCN2iB or vehicle (DMSO) control as indicated for up to 6 days. Cell growth was measured ( N = 5) and plotted as fold change (mean ± standard deviation [SD]) relative to day 0. Statistical significance was determined using a two-way ANOVA is shown in .

Article Snippet: GCN2 and ATF4 knockout cell lines were generated using CRISPR/Cas9 Human Gene Knockout Kits (Origene, Cat. #KN412459 and #KN402333) using hGCN2g1 (5′- AATTTAGTTTTGTACCCTCA -3′) and hATF4g1 (5′- CTTCCTGAGCAGCGAGGTGT -3′), respectively, following the manufacturer’s protocol.

Techniques: Western Blot, Molecular Weight, Transfection, Expressing, Standard Deviation

Journal: eLife

Article Title: GCN2 eIF2 kinase promotes prostate cancer by maintaining amino acid homeostasis

doi: 10.7554/eLife.81083

Figure Lengend Snippet: H&E and IHC staining using p-GCN2-T899 antibody in prostatic needle biopsy specimens from patients with prostate cancer with Gleason scores 4 + 4 = 8 (top) or 4 + 5 = 9 (bottom). Non-malignant (left) and malignant (right) prostate tissues are highlighted for both cases.

Article Snippet: GCN2 and ATF4 knockout cell lines were generated using CRISPR/Cas9 Human Gene Knockout Kits (Origene, Cat. #KN412459 and #KN402333) using hGCN2g1 (5′- AATTTAGTTTTGTACCCTCA -3′) and hATF4g1 (5′- CTTCCTGAGCAGCGAGGTGT -3′), respectively, following the manufacturer’s protocol.

Techniques: Immunohistochemistry

Journal: eLife

Article Title: GCN2 eIF2 kinase promotes prostate cancer by maintaining amino acid homeostasis

doi: 10.7554/eLife.81083

Figure Lengend Snippet: ( A ) Volcano plot illustrating log 2 fold change in gene transcript levels with adjusted p value (−log 10 ) comparing LNCaP cells treated with GCN2iB (2 µM) versus vehicle control (DMSO) for 24 hr. Several amino acid transporters reduced by GCN2iB treatment are highlighted. ( B ) Plots from gene set enrichment analysis (GSEA) of gene expression in LNCaP cells treated with GCN2iB (2 µM) for 24 hr versus vehicle control. ( C ) Heat map displaying significantly downregulated SLC genes as indicated in panel A . The heat map compares gene transcript levels from LNCaP cells treated with vehicle (DMSO), or GCN2iB (2 µM) for 6 or 24 hr. Four biological replicates were measured for each treatment group. Transcript levels (normalized read counts) are shown relative to the average of the vehicle control samples for each gene. ( D ) Lysates were prepared from LNCaP cells treated with 2 µM GCN2iB or vehicle control (DMSO) for 6 or 24 hr and immunoblot analysis were carried out using antibodies that recognize ATF4, ASNS, xCT (SLC7A11), 4F2 (SLC3A2), CAT1 (SLC7A1), ASCT1 (SLC1A4), ASCT2 (SLC1A5), or actin. Molecular weight markers are indicated in kilodaltons. ( E ) 22Rv1 WT cells, 22Rv1 GCN2 KO cells, and 22Rv1 GCN2 KO complemented with GCN2 cells were cultured for 24 hr. Lysates were prepared and analyzed by immunoblot for the indicated proteins. ( F ) Amino acid uptake measurements in LNCaP and 22Rv1 cells treated with vehicle (DMSO) or GCN2iB (2 µM) for 24 hr. ( G ) Amino acid uptake measurements for 22Rv1 WT or 22Rv1 GCN2 KO cells cultured for 24 hr. Statistical significance was determined using an unpaired two-tailed t -test ( N = 4); *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001.

Article Snippet: GCN2 and ATF4 knockout cell lines were generated using CRISPR/Cas9 Human Gene Knockout Kits (Origene, Cat. #KN412459 and #KN402333) using hGCN2g1 (5′- AATTTAGTTTTGTACCCTCA -3′) and hATF4g1 (5′- CTTCCTGAGCAGCGAGGTGT -3′), respectively, following the manufacturer’s protocol.

Techniques: Expressing, Western Blot, Molecular Weight, Cell Culture, Two Tailed Test

Journal: eLife

Article Title: GCN2 eIF2 kinase promotes prostate cancer by maintaining amino acid homeostasis

doi: 10.7554/eLife.81083

Figure Lengend Snippet: ( A ) LNCaP cells were treated with 2 µM GCN2iB or vehicle control (DMSO) for 6 or 24 hr, protein lysates were prepared, and immunoblotted for the indicated proteins. The bar graphs show the relative levels of the indicated proteins normalized to actin. Statistical significance was determined using an unpaired two-tailed t -test. Error bars indicate standard deviation (SD) ( N = 3); *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001. ( B ) Immunoblot analysis of PC-3 WT, PC-3 GCN2 KO (clone C-2), and PC-3 GCN2 KO (clone C-3) lysates using antibodies that recognize GCN2, ATF4, ASNS, LAT1 (SLC7A5), xCT (SLC7A11), 4F2 (SLC3A2), ASNS, or actin.

Article Snippet: GCN2 and ATF4 knockout cell lines were generated using CRISPR/Cas9 Human Gene Knockout Kits (Origene, Cat. #KN412459 and #KN402333) using hGCN2g1 (5′- AATTTAGTTTTGTACCCTCA -3′) and hATF4g1 (5′- CTTCCTGAGCAGCGAGGTGT -3′), respectively, following the manufacturer’s protocol.

Techniques: Two Tailed Test, Standard Deviation, Western Blot

Journal: eLife

Article Title: GCN2 eIF2 kinase promotes prostate cancer by maintaining amino acid homeostasis

doi: 10.7554/eLife.81083

Figure Lengend Snippet: ( A ) Amino acid measurements of LNCaP cells treated with 2 µM GCN2iB or vehicle control (DMSO) for 8 hr. Bar graphs in the top panel show high abundance amino acids and the lower panel those with lower levels. The heat map on the right shows fold change in amino acid abundance for each biological replicate of GCN2iB-treated LNCaP cells versus the vehicle with the scale showing the highest fold change in yellow and lowest in purple. Statistical significance was determined using an unpaired two-tailed t -test. Error bars indicate standard deviation (SD) ( N = 3); *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p ≤ 0.0001. ( B ) LNCaP cells were treated with vehicle, GCN2iB (2 µM), vehicle + essential amino acids (EAA), or GCN2iB (2 µM) + EAA, and cell growth was measured for up to 6 days. Error bars indicate SD ( N = 5). Statistical significance was determined using a two-way analysis of variance (ANOVA) as described in ; ****p ≤ 0.0001. ( C ) Cell cycle analyses of LNCaP cells treated with vehicle, GCN2iB (2 µM), vehicle + EAA, or GCN2iB (2 µM) + EAA for 48 hr. Statistical significance was determined using a one-way ANOVA with Tukey’s multiple comparisons. Error bars indicate SD ( N = 3); ***p ≤ 0.001, ****p ≤ 0.0001. ( D ) Genome-wide tRNA charging analysis (CHARGE-seq) of LNCaP cells treated with vehicle (DMSO), GCN2iB (2 µM), or GCN2iB (2 µM) + EAA for 8 hr. The tRNA charging ratio is shown as a bar graph with fold change compared to vehicle. Only tRNA isoacceptors measured in LNCaP cells are shown. Error bars indicate SD ( N = 4). ( E ) tRNA charging percentage for tRNA His in LNCaP cells treated with vehicle, GCN2iB, or GCN2iB + EAA. Statistical significance was determine using a one-way ANOVA with Tukey’s multiple comparisons ( N = 4); ***p ≤ 0.001, ****p ≤ 0.0001. ( F ) LNCaP cells were treated with vehicle, GCN2iB (2 µM), GCN2iB (2 µM) + EAA, or GCN2iB (2 µM) combined with the indicated individual amino acids. Cell growth was measured at 4 days in triplicate wells ( N = 3). Statistical significance was determined using a one-way ANOVA with Tukey’s multiple comparisons. Error bars indicate SD; ****p ≤ 0.0001. ( G ) Cell cycle analysis of LNCaP cells were treated with vehicle, GCN2iB (2 µM), GCN2iB (2 µM) + histidine (200 µM), or with media lacking histidine for 48 hr. Statistical significance was determined using a one-way ANOVA with Tukey’s multiple comparisons. Error bars indicate SD ( N = 3); ***p ≤ 0.001, ****p ≤ 0.0001. ( H ) LNCaP cells were cultured in normal media, media supplemented with EAA mix, or media supplemented with histidine (200 µM) for 24 hr. Lysates were analyzed by Immunoblot using antibodies that recognize total or phosphorylated GCN2-T899, total or phosphorylated eIF2α−S51, ATF4, or actin. Molecular weight markers are presented in kilodaltons for each immunoblot panel. The relative levels of p-eIF2α normalized to total eIF2α compared to normal media (NM) control are indicated.

Article Snippet: GCN2 and ATF4 knockout cell lines were generated using CRISPR/Cas9 Human Gene Knockout Kits (Origene, Cat. #KN412459 and #KN402333) using hGCN2g1 (5′- AATTTAGTTTTGTACCCTCA -3′) and hATF4g1 (5′- CTTCCTGAGCAGCGAGGTGT -3′), respectively, following the manufacturer’s protocol.

Techniques: Two Tailed Test, Standard Deviation, Genome Wide, Cell Cycle Assay, Cell Culture, Western Blot, Molecular Weight

Journal: eLife

Article Title: GCN2 eIF2 kinase promotes prostate cancer by maintaining amino acid homeostasis

doi: 10.7554/eLife.81083

Figure Lengend Snippet: ( A ) LNCaP, MR49F, C4-2B, 22Rv1, or PC-3 cells were transfected with GCN2 siRNA, ATF4 siRNA, or scrambled siRNA control for 48 hr and subjected to cell cycle analysis as described in the Materials and methods. The percentage of cells in G1, S, and G2-M are shown in the bar graphs. ( B ) 22Rv1 GCN2 KO and the parental WT were analyzed for cell cycle arrest. Statistical significance was determined using a one-way analysis of variance (ANOVA) with Tukey’s multiple comparisons. Error bars indicate standard deviation (SD) ( N = 3); *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001,****p ≤ 0.0001.

Article Snippet: GCN2 and ATF4 knockout cell lines were generated using CRISPR/Cas9 Human Gene Knockout Kits (Origene, Cat. #KN412459 and #KN402333) using hGCN2g1 (5′- AATTTAGTTTTGTACCCTCA -3′) and hATF4g1 (5′- CTTCCTGAGCAGCGAGGTGT -3′), respectively, following the manufacturer’s protocol.

Techniques: Transfection, Cell Cycle Assay, Standard Deviation

Journal: eLife

Article Title: GCN2 eIF2 kinase promotes prostate cancer by maintaining amino acid homeostasis

doi: 10.7554/eLife.81083

Figure Lengend Snippet: ( A ) MR49F cells were treated with GCN2iB (2 µM) or vehicle control (DMSO) for 96 hr in normal growth media, growth media supplemented with essential amino acid (EAA), or growth media supplemented with individual amino acids as indicated. Cell growth was quantified using CellTiter-Glo as described in the Materials and methods and is presented normalized to the vehicle control group. ( B ) 22Rv1 WT and 22Rv1 GCN2 KO cells were cultured for 96 hr in normal growth media, growth media supplemented with EAA, or growth media supplemented with individual amino acids as indicated and cell growth was similarly measured as described in A . Statistical significance in panels A and B was determined using a one-way analysis of variance (ANOVA) with Tukey’s multiple comparisons. Error bars indicate standard deviation (SD) ( N = 3); ****p ≤ 0.0001.

Article Snippet: GCN2 and ATF4 knockout cell lines were generated using CRISPR/Cas9 Human Gene Knockout Kits (Origene, Cat. #KN412459 and #KN402333) using hGCN2g1 (5′- AATTTAGTTTTGTACCCTCA -3′) and hATF4g1 (5′- CTTCCTGAGCAGCGAGGTGT -3′), respectively, following the manufacturer’s protocol.

Techniques: Cell Culture, Standard Deviation

Journal: eLife

Article Title: GCN2 eIF2 kinase promotes prostate cancer by maintaining amino acid homeostasis

doi: 10.7554/eLife.81083

Figure Lengend Snippet: ( A ) Gene-level depletion for LNCaP and 22Rv1 cells. The average log2 fold change for the single guide RNAs (sgRNAs) for each gene is shown on the x -axis. Significantly depleted genes (p ≤ 0.05) in LNCaP or 22Rv1 are indicated. Circle size indicates the number of significant sgRNAs. SLC genes in red are dependent on GCN2 for expression. ( B ) Plot of −Log 10 (p value) for depleted genes identified in CRISPR screen for LNCaP versus 22Rv1 cells. Significantly depleted genes (p ≤ 0.05) in LNCaP, 22Rv1 or both cell lines are indicated. SLC genes in red are GCN2 dependent. ( C ) Lysates from LNCaP cells were treated with 2 µM GCN2iB for 6 or 24 hr, or with vehicle (DMSO) were analyzed by immunoblot analyses using antibodies that recognize total or phosphorylated GCN2-T899, ATF4, 4F2 (SLC3A2), or actin. Molecular weight markers are indicated in kilodaltons for the panels. ( D ) LNCaP cells were cultured in standard culture conditions (NM: normal media), media supplemented with 200 µM histidine (+His), or media depleted of histidine (−His) for 24 hr. Lysates were analyzed by immunoblot analyses using antibodies that recognize total or phosphorylated GCN2-T899, ATF4, 4F2 (SLC3A2), or actin. ( E ) LNCaP cells were treated with 100 nM halofuginone (HF) for 2 and 6 hr or vehicle (DMSO). Lysates were analyzed by Immunoblot using antibodies that recognize the indicated proteins. ( F ) 4F2 (SLC3A2) expression was reduced in LNCaP or 22Rv1 cells using two different siRNAs or scramble siRNA as a control. Cell growth was measured in replicate wells ( N = 5) for up to 6 days and are plotted relative to day 0 (mean ± standard deviation [SD]). Statistical significance was determined using a two-way analysis of variance (ANOVA) as described in ; ****p ≤ 0.0001. ( G ) LNCaP cells transfected with two different siRNAs targeting 4F2 (SLC3A2) or scramble siRNA for 48 hr. Lysate was prepared and analyzed by immunoblot using antibodies that recognize total or phosphorylated GCN2-T899, total or phosphorylated eIF2α−S51, ATF4, 4F2 (SLC3A2), or actin. ( H ) LNCaP cells stably overexpressing SLC3CA2 or vector control were transfected with two different siRNAs targeting GCN2 or scrambled control. Cells were then treated with GCN2iB (2 µM) or vehicle and growth was measured in replicate wells ( N = 5) and is plotted relative to day 0 (mean ± SD). Statistical significance was determined using a two-way ANOVA as described in ; **p ≤ 0.01, ****p ≤ 0.0001. ( I ) Amino acid measurements of LNCaP cells transfected siRNA targeting GCN2 ( N = 4), 4F2 (SLC3A2, N = 4), or scramble control ( N = 8). Two separate bar graphs show high abundance (top) and low abundance (bottom) amino acids. Statistical significance was determined using a two-way ANOVA as described in . Error bars indicate SD; *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001; ****p ≤ 0.0001.

Article Snippet: GCN2 and ATF4 knockout cell lines were generated using CRISPR/Cas9 Human Gene Knockout Kits (Origene, Cat. #KN412459 and #KN402333) using hGCN2g1 (5′- AATTTAGTTTTGTACCCTCA -3′) and hATF4g1 (5′- CTTCCTGAGCAGCGAGGTGT -3′), respectively, following the manufacturer’s protocol.

Techniques: Expressing, CRISPR, Western Blot, Molecular Weight, Cell Culture, Standard Deviation, Transfection, Stable Transfection, Plasmid Preparation

Journal: eLife

Article Title: GCN2 eIF2 kinase promotes prostate cancer by maintaining amino acid homeostasis

doi: 10.7554/eLife.81083

Figure Lengend Snippet: ( A ) LNCaP cells were treated with GCN2iB (2 µM) or vehicle (DMSO) control in the presence or absence of salubrinal (50 µM) for 48 hr. Protein lysates were prepared and analyzed by immunoblot using antibodies that recognize total or phosphorylated GCN2, total or phosphorylated eIF2α, ATF4, 4F2 (SLC3A2), or actin as indicated. ( B ) LNCaP cells transfected with empty vector (EV) control or pMSCV-GADD34-puro expression plasmid encoding the human GADD34 gene were analyzed by immunoblot as indicated in panel A. ( C ) Protein lysates prepared from LNCaP or 22Rv1 stably expressing empty vector (EV) control or 4F2 (SLC3A2) were analyzed by immunoblot using antibodies that recognize total or phosphorylated GCN2, total or phosphorylated eIF2α(S-51), ATF4, or actin as indicated. ( D ) Growth of LNCaP and 22Rv1 cells stably expressing empty vector (EV) control or 4F2 (SLC3A2) was measured in replicate wells ( N = 5) for up to 4 days and plotted as fold change (mean ± standard deviation [SD]) relative to day 0. Statistical significance was determined using a two-way analysis of variance (ANOVA) as described in ; ****p ≤ 0.0001.

Article Snippet: GCN2 and ATF4 knockout cell lines were generated using CRISPR/Cas9 Human Gene Knockout Kits (Origene, Cat. #KN412459 and #KN402333) using hGCN2g1 (5′- AATTTAGTTTTGTACCCTCA -3′) and hATF4g1 (5′- CTTCCTGAGCAGCGAGGTGT -3′), respectively, following the manufacturer’s protocol.

Techniques: Western Blot, Transfection, Plasmid Preparation, Expressing, Stable Transfection, Standard Deviation

Journal: eLife

Article Title: GCN2 eIF2 kinase promotes prostate cancer by maintaining amino acid homeostasis

doi: 10.7554/eLife.81083

Figure Lengend Snippet: Model depicting the role of GCN2 in regulating SLC amino acid transporters. Enhanced translation and altered metabolism driven by oncogenes deplete amino acid pools resulting in accumulation of uncharged tRNAs, leading to activation of GCN2. Active GCN2 results in increased expression of SLC amino acid transporters, including 4F2 (SLC3A2), to increase uptake of amino acids. Loss of GCN2 function disrupts amino acid homeostasis decreasing proliferation of prostate cancer cells.

Article Snippet: GCN2 and ATF4 knockout cell lines were generated using CRISPR/Cas9 Human Gene Knockout Kits (Origene, Cat. #KN412459 and #KN402333) using hGCN2g1 (5′- AATTTAGTTTTGTACCCTCA -3′) and hATF4g1 (5′- CTTCCTGAGCAGCGAGGTGT -3′), respectively, following the manufacturer’s protocol.

Techniques: Activation Assay, Expressing

Journal: eLife

Article Title: GCN2 eIF2 kinase promotes prostate cancer by maintaining amino acid homeostasis

doi: 10.7554/eLife.81083

Figure Lengend Snippet: ( A ) WT or GCN2 KO 22Rv1 (clone 7) cells were injected subcutaneously into the dorsal flank of mice as described in the Materials and methods. Tumor volume (TV) was measured on indicated days and is plotted as average TV ± standard error of the mean (SEM) ( N = 4). Statistical significance was determined using a two-way analysis of variance (ANOVA) with Sidak’s multiple comparison; *p ≤ 0.05; ****p ≤ 0.0001. On the right bar graph, the final tumor weight was measured at endpoint and statistical significance was determined using an unpaired two-tailed t -test. Error bars indicate standard deviation (SD); **p ≤ 0.01. ( B ) Protein lysates were prepared from WT and GCN2 KO 22Rv1 tumors and analyzed by immunoblot to measure total GCN2, ATF4, LAT1 (SLC7A5), xCT (SLC7A11), 4F2 (SLC3A2), androgen receptor (AR), AR splice variant 7 (AR-V7), or actin. Molecular weight markers are indicated in kilodaltons for each immunoblot panel. The levels of the SLC proteins normalized to actin are shown in the bar graph (right panels). Statistical significance was determined using an unpaired two-tailed t -test. Error bars indicate SD ( N = 4); *p ≤ 0.05; ***p ≤ 0.001. ( C ) Tumor growth of PC-3 WT and PC-3 GCN2 KO (clone 3) cells was analyzed in a mouse xenograft study as in A. Statistical significance was determined using a two-way ANOVA with Sidak’s multiple comparison. Error bars indicate SEM ( N = 5); ***p ≤ 0.001; ****p ≤ 0.0001. On the right bar graph, the final tumor weight was measured at endpoint. Statistical significance was determined using an unpaired two-tailed t -test. Error bars indicate SD ( N = 5); *p ≤ 0.01. ( D ) Protein lysates were prepared from the PC-3 WT and PC-3 GCN2 KO tumors and analyzed by immunoblot for the indicated proteins. (Right panels) Quantification of protein levels of LAT1 (SLC7A5), xCT (SLC7A11), and 4F2 (SLC3A2) normalized to actin are shown in the bar graphs. Statistical significance was determined using an unpaired two-tailed t -test. Error bars indicate SD ( N = 4); **p ≤ 0.01. ( E ) 22Rv1 WT ( N = 4), 22Rv1 GCN2 KO (clone 7, N = 5), and 22Rv1 ATF4 KO ( N = 5) were evaluated in the mouse xenograft model. Tumor volumes were measured on the indicated days. Error bars indicated SEM. ( F ) Amino acid measurements of 22Rv1 WT, 22Rv1 GCN2 KO, and 22Rv1 ATF4 KO tumors. Two separate bar graphs show high abundance (top) and low abundance (bottom) amino acids. Statistical significance was determined one-way ANOVA with Tukey’s multiple comparisons. Error bars indicate SD ( N = 4); # p ≤ 0.1, *p ≤ 0.05. ( G ) 22Rv1 WT and 22Rv1 GCN2 KO (clone 7) cells were analyzed in a xenograft model as described for ( A ), with or without supplementation of essential amino acid (EAA) in the drinking water. Tumor volume was measured on indicated days. 22Rv1 WT ( N = 4) and 22Rv1 KO ( N = 5) are the same tumor growth curves shown in ( E ). 22Rv1 WT + EAA ( N = 5), 22Rv1 GCN2 KO + EAA ( N = 5). Statistical significance was determined using a two-way ANOVA with Sidak’s multiple comparison; ****p ≤ 0.0001. ( H ) Amino acid measurements for 22Rv1 WT, 22Rv1 GCN2, and 22Rv1 GCN2 KO + EAA tumors. Bar graphs show only amino acids present in EAA supplemented water. Statistical significance was determined using a one-way ANOVA with Tukey’s multiple comparisons. Error bars indicated SD ( N = 4); # p ≤ 0.1; *p ≤ 0.05; **p ≤ 0.01. ( I ) Tumor growth curves for 22Rv1 WT or 22Rv1 GCN2 KO (clone 11) transduced with 4F2 (SLC3A2) lentivirus (WT + 4F2 and GCN2 KO + 4F2) or empty vector (WT + EV and GCN2 KO + EV). Tumor volumes were measured on indicated days. Error bars indicate SEM ( N = 5). Statistical significance was determined using a two-way ANOVA with Sidak’s multiple comparison; ****p ≤ 0.0001.

Article Snippet: GCN2 and ATF4 knockout cell lines were generated using CRISPR/Cas9 Human Gene Knockout Kits (Origene, Cat. #KN412459 and #KN402333) using hGCN2g1 (5′- AATTTAGTTTTGTACCCTCA -3′) and hATF4g1 (5′- CTTCCTGAGCAGCGAGGTGT -3′), respectively, following the manufacturer’s protocol.

Techniques: Injection, Two Tailed Test, Standard Deviation, Western Blot, Variant Assay, Molecular Weight, Transduction, Plasmid Preparation

Journal: eLife

Article Title: GCN2 eIF2 kinase promotes prostate cancer by maintaining amino acid homeostasis

doi: 10.7554/eLife.81083

Figure Lengend Snippet: ( A ) Representative images for Ki-67, p-GCN2-T899, or 4F2 (SLC3A2) staining of 22Rv1 WT and 22Rv1 GCN2 KO tumors are shown. Bar graph shows quantification for percent positive nuclear staining (Ki67) or Histoscore (p-GCN2-T899 and 4F2). Statistical significance was determined using an unpaired two-tailed t -test. Error bars indicate standard deviation (SD) ( N = 4); **p ≤ 0.01, ****p ≤ 0.0001. ( B ) PC-3 WT, and PC-3 GCN2 KO clone 2 (C-2), or PC-3 GCN2 KO clone 3 (C-3) cells were injected subcutaneously into the dorsal flank of mice as described in the Materials and methods. Tumor volumes were measured on the indicated days. Statistical significance was determined using a two-way analysis of variance (ANOVA) with Sidak’s multiple comparison. Error bars indicate standard error of the mean (SEM) ( N = 5); *p ≤ 0.05; ***p ≤ 0.001; ****p ≤ 0.0001. Bar graph indicates final tumor weight measured at endpoint. Statistical significance was determined using a one-way ANOVA with Tukey’s multiple comparisons. Error bars indicate SD ( N = 5); **p ≤ 0.01. ( C ) Representative images for Ki-67, p-GCN2-T899, or 4F2 (SLC3A2) staining of PC-3 WT and PC-3 GCN2 KO tumors are shown. Bar graph shows quantification for percent positive nuclear staining (Ki67) or Histoscore (p-GCN2-T899 and 4F2). Statistical significance was determined using an unpaired two-tailed t -test. Error bars indicate SD ( N = 5); *p ≤ 0.05; **p ≤ 0.01.

Article Snippet: GCN2 and ATF4 knockout cell lines were generated using CRISPR/Cas9 Human Gene Knockout Kits (Origene, Cat. #KN412459 and #KN402333) using hGCN2g1 (5′- AATTTAGTTTTGTACCCTCA -3′) and hATF4g1 (5′- CTTCCTGAGCAGCGAGGTGT -3′), respectively, following the manufacturer’s protocol.

Techniques: Staining, Two Tailed Test, Standard Deviation, Injection

Journal: eLife

Article Title: GCN2 eIF2 kinase promotes prostate cancer by maintaining amino acid homeostasis

doi: 10.7554/eLife.81083

Figure Lengend Snippet: ( A ) Lysates from 22Rv1 WT, 22Rv1 GCN2 KO, and 22Rv1 ATF4 KO tumors were subjected to immunoblot analyses to measure total or phosphorylated GCN2, total or phosphorylated eIF2α, ATF4, LAT1 (SLC7A5), xCT (SLC7A11), 4F2 (SLC3A2), CAT1 (SLC7A1), ASCT1 (SLC1A4), ASCT2 (SLC1A5), androgen receptor (AR), AR splice variant 7 (AR-V7), or actin. Molecular weight markers are indicated in kilodaltons for each immunoblot panel. Levels of the indicated proteins normalized to appropriate control are shown in the bar graph on the right. Statistical significance was determined using a one-way analysis of variance (ANOVA) with Tukey’s multiple comparisons. Error bars indicate standard deviation (SD) ( N = 4); ns, p > 0.05; *p ≤ 0.05, **p ≤ 0.01, ***p ≤0.001. ( B ) LNCaP cells were transfected with siRNAs targeting GCN2 ( N = 4), ATF4 ( N = 4), or scramble control ( N = 8) for 48 hr. Amino acid levels were determined as described in the Materials and methods. Error bars indicate SD. Statistical significance was determined using a one-way ANOVA with Tukey’s multiple comparisons; # p ≤ 0.1, *p ≤ 0.05, **p ≤ 0.01, ***p ≤0.001, ****p ≤0.0001. Scramble control and GCN2 knockdown samples are the same as in .

Article Snippet: GCN2 and ATF4 knockout cell lines were generated using CRISPR/Cas9 Human Gene Knockout Kits (Origene, Cat. #KN412459 and #KN402333) using hGCN2g1 (5′- AATTTAGTTTTGTACCCTCA -3′) and hATF4g1 (5′- CTTCCTGAGCAGCGAGGTGT -3′), respectively, following the manufacturer’s protocol.

Techniques: Western Blot, Variant Assay, Molecular Weight, Standard Deviation, Transfection

Journal: eLife

Article Title: GCN2 eIF2 kinase promotes prostate cancer by maintaining amino acid homeostasis

doi: 10.7554/eLife.81083

Figure Lengend Snippet: ( A ) Body weight measurements from mice bearing 22Rv1 WT or 22Rv1 GCN2 KO tumors with or without EAA supplementation in the drinking water as described in . Statistical significance was determined using a two-way analysis of variance (ANOVA) with Sidak’s multiple comparison, **p ≤ 0.01. ( B ) Amino acid measurements for 22Rv1 WT, 22Rv1 GCN2 KO, or 22Rv1 GCN2 KO + EAA tumors. Bar graphs show only amino acids not present in EAA supplemented water. Error bars indicate standard deviation (SD) ( N = 4). Statistical significance was determined using a one-way ANOVA with Tukey’s multiple comparisons; # p ≤ 0.1; *p ≤ 0.05. ( C ) Protein lysates were prepared from tumors described in and analyzed by immunoblot to measure total GCN2, LAT1 (SLC7A5), xCT (SLC7A11), 4F2 (SLC3A2), CAT1 (SLC7A1), ASCT1 (SLC1A4), ASNS, androgen receptor (AR), AR splice variant 7 (ARv7), or actin. Molecular weight markers are indicated in kilodaltons for each immunoblot panel. The levels of the indicated proteins normalized to actin are shown in the bar graphs. Statistical significance was determined using a one-way ANOVA with Tukey’s multiple comparisons. Error bars indicate SD ( N = 4); ns, p > 0.05; *p ≤ 0.05, **,p ≤ 0.01, ***p ≤ 0.001, ****p ≤ 0.0001.

Article Snippet: GCN2 and ATF4 knockout cell lines were generated using CRISPR/Cas9 Human Gene Knockout Kits (Origene, Cat. #KN412459 and #KN402333) using hGCN2g1 (5′- AATTTAGTTTTGTACCCTCA -3′) and hATF4g1 (5′- CTTCCTGAGCAGCGAGGTGT -3′), respectively, following the manufacturer’s protocol.

Techniques: Standard Deviation, Western Blot, Variant Assay, Molecular Weight

Journal: eLife

Article Title: GCN2 eIF2 kinase promotes prostate cancer by maintaining amino acid homeostasis

doi: 10.7554/eLife.81083

Figure Lengend Snippet: ( A ) Amino acid measurements from 22Rv1 WT + EV, 22Rv1 GCN2 KO + EV, and 22Rv1 GCN2 KO + 4F2 (SLC3A2) tumors. Two separate bar graphs show high abundance (top) and low abundance (bottom) amino acids. Statistical significance was determined using a one-way analysis of variance (ANOVA) with Tukey’s multiple comparisons. Error bars indicate standard deviation (SD) ( N = 4); # p ≤ 0.1, **p ≤ 0.01. ( B ) Lysates were prepared from these tumors in A were analyzed by immunoblot to measure total GCN2, 4F2 (SLC3A2), or actin. A long and short exposure for the 4F2 (SLC3A2) immunoblot is shown. Molecular weight markers are indicated in kilodaltons for each immunoblot panel.

Article Snippet: GCN2 and ATF4 knockout cell lines were generated using CRISPR/Cas9 Human Gene Knockout Kits (Origene, Cat. #KN412459 and #KN402333) using hGCN2g1 (5′- AATTTAGTTTTGTACCCTCA -3′) and hATF4g1 (5′- CTTCCTGAGCAGCGAGGTGT -3′), respectively, following the manufacturer’s protocol.

Techniques: Standard Deviation, Western Blot, Molecular Weight

Journal: eLife

Article Title: GCN2 eIF2 kinase promotes prostate cancer by maintaining amino acid homeostasis

doi: 10.7554/eLife.81083

Figure Lengend Snippet: Male NSG mice were injected subcutaneously with LNCaP ( N = 5) ( A ) or 22Rv1 ( N = 4) ( B ) cells, or alternatively implanted with tumor fragments from an androgen-sensitive tumor TM00298 ( N = 5) ( C ). Male castrated NSG mice were implanted with tumor fragments from LuCaP-35 CR tumors ( N = 5) ( D ). Mice were treated with vehicle or 30 mg/kg GCN2iB twice daily for 5 days/week and tumor volumes were measured on indicated days. Statistical significance was determined using a two-way analysis of variance (ANOVA) with Sidak’s multiple comparison. Error bars indicate standard error of the mean (SEM); *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p ≤ 0.0001. Final tumor weight was measured at endpoint and is represented in bar graphs (right panels). Statistical significance was determined using an unpaired two-tailed t -test. Error bars indicate standard deviation (SD); *p ≤ 0.05. ( E ) Protein lysates were prepared from 22Rv1 tumors treated with vehicle or GCN2iB and analyzed by immunoblot for phosphorylated GCN2-T899, ATF4, LAT1 (SLC7A5), xCT (SLC7A11), and 4F2 (SLC3A2), and actin. The levels of the SLC proteins normalized to actin are shown. Phosphorylated GCN2-T899 was normalized to total GCN2. Statistical significance was determined using an unpaired two-tailed t -test. Error bars indicate SD ( N = 4); *p ≤ 0.05. ( F ) Amino acid measurements of 22Rv1 tumors treated with vehicle or GCN2iB. Bar graphs show high abundance (top) and low abundance (bottom) amino acids. Statistical significance was determined using an unpaired two-tailed t -test. Error bars indicate SD ( N = 4); # p ≤ 0.1; *p ≤ 0.05; **p ≤ 0.01. ( G ) Pearson correlation between p-GCN2-T899 and 4F2 (SLC3A2) histoscores calculated from IHC staining from a prostate tumor microarray (Biomax PR807c) containing normal ( N = 10), hyperplasia ( N = 20), and malignant ( N = 50) for all tissues (combined) or Gleason scores 4 and 5. The center lines depict linear regression (95% confidence intervals). Not all samples were analyzed due to damaged/quality of tissue samples. Levels of p-GCN2-T899 and 4F2 (SLC3A2) were measured by IHC staining and QuPath was used to determine the histoscore. Two representative cases are shown for high (Case 1) and low (Case 2) p-GCN2-T899 and 4F2 (SLC3A2) staining. Scale bar indicates 200 µm (main image) and 20 µm (insert). ( H ) Correlation of expression of 4F2 (SLC3A2) and a GCN2-dependent gene signature in prostate adenocarcinoma (PRAD, N = 551) from the Cancer Genome Atlas (TCGA). The GCN2-dependepent gene signature was derived from RNA-seq data as described in the Materials and methods.

Article Snippet: GCN2 and ATF4 knockout cell lines were generated using CRISPR/Cas9 Human Gene Knockout Kits (Origene, Cat. #KN412459 and #KN402333) using hGCN2g1 (5′- AATTTAGTTTTGTACCCTCA -3′) and hATF4g1 (5′- CTTCCTGAGCAGCGAGGTGT -3′), respectively, following the manufacturer’s protocol.

Techniques: Injection, Two Tailed Test, Standard Deviation, Western Blot, Immunohistochemistry, Microarray, Staining, Expressing, Derivative Assay, RNA Sequencing Assay

Journal: eLife

Article Title: GCN2 eIF2 kinase promotes prostate cancer by maintaining amino acid homeostasis

doi: 10.7554/eLife.81083

Figure Lengend Snippet: Male NSG mice were injected subcutaneously with LNCaP ( N = 5) or 22Rv1 ( N = 4) cells, or implanted with tumor fragments from an androgen-sensitive tumor TM00298 ( N = 5) or the castration-resistant LuCaP-35 CR ( N = 5) tumor and treated as described in . ( A ) Representative images showing IHC staining for Ki-67 or p-GCN2-T899 from tumor described above. Bar graphs show quantification of percent positive nuclear staining (Ki67) or Histoscore (p-GCN2-T899). Error bars indicate standard deviation (SD). Statistical significance was determined using an unpaired two-tailed t -test; *p ≤0.05; **p ≤ 0.01. ( B ) Mouse body weight was measured on indicated days for mice bearing LNCaP, 22Rv1, TM00298, or LuCaP-35 CR tumors treated with vehicle or GCN2iB as described in .

Article Snippet: GCN2 and ATF4 knockout cell lines were generated using CRISPR/Cas9 Human Gene Knockout Kits (Origene, Cat. #KN412459 and #KN402333) using hGCN2g1 (5′- AATTTAGTTTTGTACCCTCA -3′) and hATF4g1 (5′- CTTCCTGAGCAGCGAGGTGT -3′), respectively, following the manufacturer’s protocol.

Techniques: Injection, Immunohistochemistry, Staining, Standard Deviation, Two Tailed Test

Journal: eLife

Article Title: GCN2 eIF2 kinase promotes prostate cancer by maintaining amino acid homeostasis

doi: 10.7554/eLife.81083

Figure Lengend Snippet: ( A ) The protein levels of 4F2 (SLC3A2) were measured in a prostate tumor microarray (Biomax PR807c) using immunohistochemistry (IHC). Staining for 4F2 (SLC3A2) from normal prostate tissue ( N = 10) and malignant prostate cancer tissue ( N = 50) was analyzed and quantified using QuPath to determine the histoscore and is represented as a scatterplot. Statistical significance was determined using an unpaired two-tailed t -test; *p ≤ 0.05. Representative images showing 4F2 (SLC3A2) staining of normal and malignant prostate tissues are shown. Scale bars: 200 µm (main image) and 20 µm (insert). ( B ) H&E and IHC staining using p-GCN2-T899 or 4F2 (SLC3A2) antibody in prostate needle biopsy specimens from patients with high grade prostate cancer with Gleason scores 5 + 4 = 9 (top) or 4 + 5 = 9 (bottom).

Article Snippet: GCN2 and ATF4 knockout cell lines were generated using CRISPR/Cas9 Human Gene Knockout Kits (Origene, Cat. #KN412459 and #KN402333) using hGCN2g1 (5′- AATTTAGTTTTGTACCCTCA -3′) and hATF4g1 (5′- CTTCCTGAGCAGCGAGGTGT -3′), respectively, following the manufacturer’s protocol.

Techniques: Microarray, Immunohistochemistry, Two Tailed Test, Staining

Journal: The Journal of Biological Chemistry

Article Title: Genomic determinants implicated in the glucocorticoid-mediated induction of KLF9 in pulmonary epithelial cells

doi: 10.1074/jbc.RA120.015755

Figure Lengend Snippet: Effect of budesonide on KLF expression in human epithelial cells and lung tissue. A , data were obtained from microarray analyses performed on A549, BEAS-2B, primary human bronchial epithelial (HBE) , and human bronchial biopsies (tissue) . Cells were exposed to maximally effective concentrations of budesonide (300 nM for A549 and BEAS-2B, or 100 nM for HBE) for 6 h prior to harvest. Bronchial biopsies were collected ∼6 h post high-dose budesonide (1600 μg) inhalation. In each case, the heatmap depicts the effect (log 2 fold) of budesonide treatment on the expression of the 17 KLFs, as compared with time-matched no treatment control, for cultured cells, or placebo inhalation, for the tissues. B , RNA-seq analysis of A549 cells treated with 300 nM budesonide for the indicated time points. The heatmap depicts the effect (log 2 fold) of budesonide treatment on the expression of the 17 KLFs when compared with no treatment control at each time point according to the same scale as in panel A . C , A549 cells were either not treated or treated with 300 nM budesonide (Bud) prior to harvesting at the indicated times for western analysis of KLF9 and GAPDH. Representative blots are shown (upper panels). Following densitometric analysis, data ( N = 4), as KLF9/GAPDH were expressed as log 2 fold relative to no treatment at 1 h and are plotted as means ± SE (lower panel). Significance, using normalized KLF9/GAPDH values relative to control at 1 h, was tested by ANOVA with Tukey’s post-hoc test. ∗∗∗ p ≤ 0.001.

Article Snippet: The human pulmonary type II cell line, A549 (American Type Culture Collection; ATCC), was grown in Dulbecco’s modified Eagle’s medium (DMEM) (11995065, Thermo) supplemented with 10% fetal bovine serum (FBS) (A3160702, Thermo) and 2 mM L-glutamine (25030081, Thermo).

Techniques: Expressing, Microarray, Control, Cell Culture, RNA Sequencing, Western Blot

Journal: The Journal of Biological Chemistry

Article Title: Genomic determinants implicated in the glucocorticoid-mediated induction of KLF9 in pulmonary epithelial cells

doi: 10.1074/jbc.RA120.015755

Figure Lengend Snippet: Regulation of KLF9 expression by glucocorticoids and/or IL1B in human pulmonary epithelial cell models. A549 cells ( A – B ) and primary human bronchial epithelial (HBE) cells grown in submersion culture ( C – D ), or air–liquid interface (ALI) culture ( E – F ) were either not treated or treated with IL1B (1 ng/ml), glucocorticoid (300 nM budesonide (Bud) or 1 μM dexamethasone (Dex)), or the combination for the indicated times. A , C , and E , cells were harvested for RNA and qPCR was performed for KLF9 and GAPDH. Data ( N = 4–5), expressed as KLF9/GAPDH, were plotted as log 2 fold relative to no treatment control at each time point. B , D , and F , cells were harvested for western blot analysis of KLF9 and GAPDH. Representative blots are shown (upper panels). Following densitometric analysis, data ( N = 4–5), as KLF9/GAPDH were expressed as log 2 fold relative to no treatment and are plotted as means ± SE ( A and C ), or box-and-whiskers plots ( B , D , E , and F ). Significance, using normalized KLF9/GAPDH values relative to no treatment control at each time, was tested by ANOVA with Tukey’s post-hoc test. ∗ p ≤ 0.05, ∗∗ p ≤ 0.01, ∗∗∗ p ≤ 0.001.

Article Snippet: The human pulmonary type II cell line, A549 (American Type Culture Collection; ATCC), was grown in Dulbecco’s modified Eagle’s medium (DMEM) (11995065, Thermo) supplemented with 10% fetal bovine serum (FBS) (A3160702, Thermo) and 2 mM L-glutamine (25030081, Thermo).

Techniques: Expressing, Control, Western Blot

Journal: The Journal of Biological Chemistry

Article Title: Genomic determinants implicated in the glucocorticoid-mediated induction of KLF9 in pulmonary epithelial cells

doi: 10.1074/jbc.RA120.015755

Figure Lengend Snippet: GR binding and transcriptional activity at the KLF9 locus following glucocorticoid treatment. A , genome browser snapshot of the KLF9 gene along with ∼70 kb upstream of KLF9 . Arrow heads within the single intron indicate direction of transcription. GR ChIP-seq traces following a 1 h treatment of BEAS-2B cells with vehicle control (veh) or 100 nM dexamethasone (Dex) are shown (data from Kadiyala et al. , 2016 ; upper two tracks). GRO-seq data showing nascent RNA mapped to the same region upon vehicle or Dex treatment, as above, for 30 min in BEAS-2B cells are shown (data from Sasse et al. , 2019 ; lower two tracks). Nascent transcripts mapped to the (+) or (−) strands are shown in blue or red , respectively. Approximate positions of qPCR amplicons for the detection of GR ChIP peaks ( light blue ), mRNA ( dark red ), unspliced RNA (usRNA) ( bright red ), and enhancer RNA (eRNA) ( orange ) are highlighted. B , A549 or primary HBE cells were either not stimulated or treated with 300 nM budesonide for 1 h prior to ChIP-PCR for GR. PCR primers were designed to span an intronic GR binding site (GBS) in the FKBP5 gene (positive control), as well as the four GBSs upstream of KLF9 ; P1, P2, P3, and P4 ( light blue boxes in A ). PCR data were normalized to the geometric mean of three control regions that are not occupied by GR. Normalized data, N = 3 to 4 (performed with two technical replicates), were plotted as log 2 fold enrichment relative to no treatment control. A549 cells ( C ), primary HBE cells in submersion culture ( D ), or primary HBE cells in ALI culture ( E ) were either not stimulated or treated with glucocorticoid (300 nM budesonide ( C and E ) or 1 μM dexamethasone ( D )) for the indicated times prior to qPCR analysis of: mature KLF9 mRNA, KLF9 usRNA, and the four eRNAs, e1, e2.1, e2.2, and e4. Primers are as indicated in panel A . For normalization, GAPDH (for mRNA) and U6 (for usRNA and eRNAs) were also assayed. Normalized data ( N = 3–4) were plotted as log 2 fold relative to not stimulated control at each time point. Data are shown as box-and-whiskers plots ( B and E ) or as means ± SE ( C – D ). Significance, using normalized data relative to no treatment control at each time, was tested by paired t test. ∗ p ≤ 0.05, ∗∗ p ≤ 0.01, ∗∗∗ p ≤ 0.001.

Article Snippet: The human pulmonary type II cell line, A549 (American Type Culture Collection; ATCC), was grown in Dulbecco’s modified Eagle’s medium (DMEM) (11995065, Thermo) supplemented with 10% fetal bovine serum (FBS) (A3160702, Thermo) and 2 mM L-glutamine (25030081, Thermo).

Techniques: Binding Assay, Activity Assay, ChIP-sequencing, Control, Positive Control

Journal: The Journal of Biological Chemistry

Article Title: Genomic determinants implicated in the glucocorticoid-mediated induction of KLF9 in pulmonary epithelial cells

doi: 10.1074/jbc.RA120.015755

Figure Lengend Snippet: Glucocorticoid-mediated induction of KLF9 is GR-dependent. A , A549 cells were either not stimulated or treated with 1 μM of GR antagonist, Org34517 (ORG), for 30 min prior to stimulation with increasing concentrations of budesonide (Bud), as indicated. After 6 h, cells were harvested for RNA and qPCR was performed for KLF9 and GAPDH. Data ( N = 4), expressed as KLF9/GAPDH, were plotted as fold change relative to no treatment control and concentration-response curves were constructed. B – C , A549 cells were incubated with transfection lipid alone (naïve; black ), or lipid plus 1 nM of nontargeting siRNA (siControl; gray ) or 1 nM of a pool of four siRNAs against GR (siGR; green ) for 36 h. Cells were then either not stimulated or treated by 300 nM budesonide (Bud) for 6 h. B , cells were harvested for western blot analysis of GR, KLF9, and GAPDH. Representative blots are shown ( upper panel ). Following densitometric analysis, data ( N = 4), were expressed as log 2 of the normalization product (gene/GAPDH). C , cells were harvested for RNA and qPCR was performed for KLF9 mRNA, KLF9 usRNA, and the four eRNAs, 1, 2.1, 2.2, and 4. For normalization, GAPDH and U6 were also assayed. Normalized data ( N = 4), as mRNA/GAPDH, usRNA/U6, or eRNA/U6, were plotted as log 2 fold relative to no treatment of each condition (naïve, siControl, or siGR). B – C , significance ( p ≤ 0.05), using normalized data relative to naïve ($) or siControl (#) groups, was tested by ANOVA with Tukey’s post hoc test. Data are shown as mean ± SE ( A ) or as box-and-whiskers plots ( B – C ). “ns” = not significant.

Article Snippet: The human pulmonary type II cell line, A549 (American Type Culture Collection; ATCC), was grown in Dulbecco’s modified Eagle’s medium (DMEM) (11995065, Thermo) supplemented with 10% fetal bovine serum (FBS) (A3160702, Thermo) and 2 mM L-glutamine (25030081, Thermo).

Techniques: Control, Concentration Assay, Construct, Incubation, Transfection, Western Blot

Journal: The Journal of Biological Chemistry

Article Title: Genomic determinants implicated in the glucocorticoid-mediated induction of KLF9 in pulmonary epithelial cells

doi: 10.1074/jbc.RA120.015755

Figure Lengend Snippet: Reporter activity of isolated KLF9 GBSs. A , schematic of the KLF9 gene along with the ∼70 kb upstream region harboring the four GBSs described in Figure 3 . For consistency, the default GRCh38 convention for positive (+) and negative (‒) strand orientation was adopted, where the KLF9 gene is shown as a (‒) strand gene. Black boxes indicate approximate positions of KLF9 GBSs that were PCR-amplified prior to cloning upstream of a luciferase reporter. B , schematic illustrating the orientation of the cloned GBSs upstream of a luciferase reporter, where (+) resembles enhancer activity away from the KLF9 locus and (‒) resembles enhancer activity toward the KLF9 locus. C , A549 cells stably transfected with empty vector ( black ) or reporter constructs for the (+) ( blue ) or (‒) ( red ) orientations of the P1+2, P1, P2, P3, and P4 GBS regions (as described in A – B ) were either not treated or treated with 300 nM of budesonide for 6 h prior to luciferase assay. Data ( N = 4), expressed as log 2 fold relative to no treatment control, are plotted as box-and-whiskers. Significance, using RLU values relative to no treatment control in each reporter cells, was tested by paired t test. D , A549 cells stably transfected with empty vector or reporter constructs for the (‒) orientation of the P1+2, P1, P2, P3, and P4 GBSs were incubated with either 1 nM of a pool of 4 nontargeting siRNAs (siControl; black ) or 1 nM of a pool of 4 siRNAs targeting GR (siGR; green ) for 48 h. Cells were then either not treated or treated with 300 nM budesonide for 6 h prior to luciferase assay. Data ( N = 4), normalized as RLU/RLU empty for each condition (siControl or siGR), were expressed as log 2 fold relative to no treatment control and are plotted as box-and-whiskers. Significance, using fold change values relative to that of siControl group, was tested by unpaired t -test. E , schematic showing deletions generated in the P3 and P4 glucocorticoid response elements (GRE). F , A549 cells stably transfected with reporter constructs for P3(‒) or P4(‒) GBSs harboring wild-type GRE (WT; red ) or with deleted GRE (ΔGRE; black ) were either not stimulated or treated with 300 nM budesonide for 6 h prior to luciferase assay. Data ( N = 4) expressed as log 2 fold relative to no treatment control are plotted as box-and-whiskers. Significance, using fold change relative to that of WT constructs, was tested by unpaired t test. ∗ p ≤ 0.05, ∗∗ p ≤ 0.01, ∗∗∗ p ≤ 0.001.

Article Snippet: The human pulmonary type II cell line, A549 (American Type Culture Collection; ATCC), was grown in Dulbecco’s modified Eagle’s medium (DMEM) (11995065, Thermo) supplemented with 10% fetal bovine serum (FBS) (A3160702, Thermo) and 2 mM L-glutamine (25030081, Thermo).

Techniques: Activity Assay, Isolation, Amplification, Cloning, Luciferase, Clone Assay, Stable Transfection, Transfection, Plasmid Preparation, Construct, Control, Incubation, Generated

Journal: The Journal of Biological Chemistry

Article Title: Genomic determinants implicated in the glucocorticoid-mediated induction of KLF9 in pulmonary epithelial cells

doi: 10.1074/jbc.RA120.015755

Figure Lengend Snippet: Interaction between upstream GBSs and the KLF9 TSS in the absence and presence of glucocorticoid. Hi-C analysis (unbiased, genome-wide chromosome conformation capture) of untreated A549 cells or following 100 nM Dex treatment for 1 or 4 h is displayed as interaction matrices ( upper three triangular panels ). These correspond to the KLF9 locus and upstream regions containing GBS P1-4. Images were generated from publicly accessible data from Genomics of Gene Regulation (GGR) project . The intensity of the red color reflects the number of ligation events and is indicative of the interaction frequency between the two respective genomic loci joined by downward 45° sloping lines. Interaction hotspots ( A – D ) involving the four KLF9 GBSs (P1-4) and TSS are annotated and are linked with dashed lines ( lower panels ). Genome browser snapshot of the KLF9 gene along with ∼70 kb of the 5′ upstream region showing ChIP-seq traces for GR ( black ) and P300 ( red ) in A549 cells following treatment with 100 nM dexamethasone (Dex) for indicated times. Positions of KLF9 GBSs P1-4 are indicated. ChIP-seq traces are publicly accessible data from GGR project ( , ).

Article Snippet: The human pulmonary type II cell line, A549 (American Type Culture Collection; ATCC), was grown in Dulbecco’s modified Eagle’s medium (DMEM) (11995065, Thermo) supplemented with 10% fetal bovine serum (FBS) (A3160702, Thermo) and 2 mM L-glutamine (25030081, Thermo).

Techniques: Hi-C, Genome Wide, Generated, Ligation, ChIP-sequencing

Journal: The Journal of Biological Chemistry

Article Title: Genomic determinants implicated in the glucocorticoid-mediated induction of KLF9 in pulmonary epithelial cells

doi: 10.1074/jbc.RA120.015755

Figure Lengend Snippet: Effect of CBP and P300 knockdown on KLF9 expression and enhancer activity from KLF9 GBSs. A – B , A549 cells were incubated with pools of four siRNAs for 48 h. The pools were either nontargeting siRNA (siControl; black ), or siRNAs targeted to CBP (siCBP; orange ), P300 (siP300; light blue ), or combined CBP/P300 siRNAs ( dark red ). A , cells were harvested for western blot analysis of CBP, P300, and GAPDH. Representative blots are shown ( upper panel ). Following densitometric analysis, normalized data ( N = 4), expressed as log 2 (gene/GAPDH), are plotted as box-and-whiskers plots. B , cells were either not stimulated (NS) or treated with 300 nM budesonide (Bud) for 6 h prior to qPCR analysis of: mature KLF9 mRNA, KLF9 usRNA, and the four eRNAs, 1, 2.1, 2.2, and 4. For normalization, GAPDH and U6 were also assayed. Normalized data ( N = 4), expressed as log 2 (mRNA/GAPDH, usRNA/U6, or eRNA/U6), are plotted as means ± SE. C , A549 cells stably transfected with empty vector or reporter constructs for the (‒) orientation of P1+2, P1, P2, P3, and P4 GBSs were treated with siRNAs and Bud as in ( B ) prior to luciferase assay. The RLU measurements were normalized to that of the empty vector for each condition (siControl, siCBP, siP300, or siCBP + siP300). Normalized data ( N = 4), expressed as log 2 (RLU/RLU empty ), are plotted as means ± SE. Significance, using normalized data relative to siControl group for each treatment condition was tested using ANOVA with Tukey’s post hoc test. ∗ p ≤ 0.05, ∗∗ p ≤ 0.01, ∗∗∗ p ≤ 0.001.

Article Snippet: The human pulmonary type II cell line, A549 (American Type Culture Collection; ATCC), was grown in Dulbecco’s modified Eagle’s medium (DMEM) (11995065, Thermo) supplemented with 10% fetal bovine serum (FBS) (A3160702, Thermo) and 2 mM L-glutamine (25030081, Thermo).

Techniques: Knockdown, Expressing, Activity Assay, Incubation, Western Blot, Stable Transfection, Transfection, Plasmid Preparation, Construct, Luciferase

Journal: eLife

Article Title: GCN2 eIF2 kinase promotes prostate cancer by maintaining amino acid homeostasis

doi: 10.7554/eLife.81083

Figure Lengend Snippet: ( A ) Expression of the indicated eIF2α kinase was reduced in LNCaP cells using gene-specific siRNAs. Two different siRNAs were used for knockdown of each eIF2α kinase and compared to scrambled siRNA control. Cell growth was measured in replicate wells ( N = 5) for up to 6 days and is plotted as fold change (mean ± standard deviation [SD]) relative to day 0. Statistical significance was determined using a two-way analysis of variance (ANOVA) as described in ; *p ≤ 0.05, ***p ≤ 0.001, ****p ≤ 0.0001. ( B ) LNCaP cells were transfected with two different siRNAs targeting GCN2 or a scramble siRNA control and cell lysates were prepared and immunoblotted for the indicated proteins. Molecular weight markers are shown in kilodaltons. The relative levels of p-eIF2α normalized to total eIF2α compared to scramble siRNA control are indicated. ( C ) Expression of GCN2 was knocked-down in LAPC-4, C4-2B, MR49F, 22Rv1, or PC-3 cells using two different siRNAs and compared to scrambled siRNA control. Cell growth was measured for up to 6 days in replicate wells ( N = 5) as described in A . Statistical significance was determined using a two-way ANOVA as described in ; ***p ≤ 0.001, ****p ≤ 0.0001. ( D ) LNCaP cells were treated with indicated concentrations of GCN2iB and cell growth was measured for up to 6 days in replicate wells ( N = 5) as described in A . Statistical significance was determined using a two-way ANOVA as described in ; ****p ≤0.0001. ( E ) LNCaP cells were treated with GCN2iB (2 µM) or DMSO control for 24 hr and protein lysates were analyzed by immunoblot using antibodies that recognize total or phosphorylated GCN2-T899, total or phosphorylated eIF2α−S51, ATF4, or actin as indicated. Relative levels of p-eIF2α normalized to total eIF2α are shown. ( F ) Levels of p-GCN2 were measured in prostate tumor microarrays (Biomax PR1921b and PR807c) using immunohistochemistry (IHC). Staining for p-GCN2-T899 from non-malignant ( N = 33) and malignant PCa tissue ( N = 88) from patients >50 years old was analyzed and quantified using QuPath to determine the histoscore and is represented as a scatterplot. Statistical significance was determined using an unpaired two-tailed t -test; *p ≤ 0.05. Representative images showing p-GCN2-T899 staining of normal and malignant prostate tissues are shown. Scale bars shown are 200 µm (main image) and 20 µm (insert).

Article Snippet: The primary antibodies used were as follows: phospho-GCN2-T899 (Abcam Cat. #ab75836, RRID: AB_1310260 ), total GCN2 (Cell Signaling Technology Cat. #3302, RRID: AB_2277617 ), total PERK (Cell Signaling Technology Cat. #3192, RRID: AB_2095847 ), total HRI (Santa Cruz Biotechnology Cat. #sc-365239, RRID: AB_10843794 ), total PKR (Cell Signaling Technology Cat. #12297, RRID: AB_2665515 ), phospho-eIF2α-S51 (Abcam Cat. #ab32157, RRID: AB_732117 ), total eIF2α (Cell Signaling Technology Cat. #5324, RRID: AB_10692650 ), ATF4 (Cell Signaling Technology Cat. #11815, RRID: AB_2616025 ), or custom rabbit polyclonal antibody which was prepared against full-length recombinant human ATF4 protein and affinity purified, ASNS (Cell Signaling Technology, Cat. #20843S), TRIB3 (Abcam Cat. #ab75846, RRID: AB_1310768 ), GADD34 (Proteintech Cat. #10449-1-AP, RRID: AB_2168724 ), SLC7A5/LAT1 (Cell Signaling Technology Cat. #5347, RRID: AB_10695104 ), SLC7A11/xCT (Cell Signaling Technology Cat. #12691, RRID: AB_2687474 ), SLC3A2/4F2 (Cell Signaling Technology Cat. #47213, RRID: AB_2799323 ), SCL7A1/CAT1 (Proteintech Cat. #14195-1-AP, RRID: AB_2190723 ), SLC1A4/ASCT1 (Cell Signaling Technology Cat. #8442, RRID: AB_10828382 ), SLC1A5/ASCT2 (Cell Signaling Technology Cat. #5345, RRID: AB_10621427 ), AR (Cell Signaling Technology Cat. #5153, RRID: AB_10691711 ), puromycin (Millipore Cat. #MABE343, RRID: AB_2566826 ), β-actin (Sigma-Aldrich Cat. #A5441, RRID: AB_476744 ), and β-tubulin (Cell Signaling Technology Cat. #2146, RRID: AB_2210545 ).

Techniques: Expressing, Knockdown, Control, Standard Deviation, Transfection, Molecular Weight, Western Blot, Immunohistochemistry, Two Tailed Test, Staining

Journal: eLife

Article Title: GCN2 eIF2 kinase promotes prostate cancer by maintaining amino acid homeostasis

doi: 10.7554/eLife.81083

Figure Lengend Snippet: ( A ) LNCaP cells were transfected with the indicated gene-specific siRNAs or a scramble control and the protein levels of HRI, PERK, or PKR and p-eIF2α, total eIF2α, and ATF4 were measured by immunoblot. Measurements of actin were used as a protein loading control in the immunoblot experiments. Molecular weight markers are shown in kilodaltons. ( B ) The indicated PCa cell lines were transfected with siRNAs targeting GCN2 or ATF4. Protein lysates were prepared and analyzed by immunoblot to determine the levels of GCN2, ATF4, or actin as indicated. ATF4 was not detected in the LAPC-4 cells.

Article Snippet: The primary antibodies used were as follows: phospho-GCN2-T899 (Abcam Cat. #ab75836, RRID: AB_1310260 ), total GCN2 (Cell Signaling Technology Cat. #3302, RRID: AB_2277617 ), total PERK (Cell Signaling Technology Cat. #3192, RRID: AB_2095847 ), total HRI (Santa Cruz Biotechnology Cat. #sc-365239, RRID: AB_10843794 ), total PKR (Cell Signaling Technology Cat. #12297, RRID: AB_2665515 ), phospho-eIF2α-S51 (Abcam Cat. #ab32157, RRID: AB_732117 ), total eIF2α (Cell Signaling Technology Cat. #5324, RRID: AB_10692650 ), ATF4 (Cell Signaling Technology Cat. #11815, RRID: AB_2616025 ), or custom rabbit polyclonal antibody which was prepared against full-length recombinant human ATF4 protein and affinity purified, ASNS (Cell Signaling Technology, Cat. #20843S), TRIB3 (Abcam Cat. #ab75846, RRID: AB_1310768 ), GADD34 (Proteintech Cat. #10449-1-AP, RRID: AB_2168724 ), SLC7A5/LAT1 (Cell Signaling Technology Cat. #5347, RRID: AB_10695104 ), SLC7A11/xCT (Cell Signaling Technology Cat. #12691, RRID: AB_2687474 ), SLC3A2/4F2 (Cell Signaling Technology Cat. #47213, RRID: AB_2799323 ), SCL7A1/CAT1 (Proteintech Cat. #14195-1-AP, RRID: AB_2190723 ), SLC1A4/ASCT1 (Cell Signaling Technology Cat. #8442, RRID: AB_10828382 ), SLC1A5/ASCT2 (Cell Signaling Technology Cat. #5345, RRID: AB_10621427 ), AR (Cell Signaling Technology Cat. #5153, RRID: AB_10691711 ), puromycin (Millipore Cat. #MABE343, RRID: AB_2566826 ), β-actin (Sigma-Aldrich Cat. #A5441, RRID: AB_476744 ), and β-tubulin (Cell Signaling Technology Cat. #2146, RRID: AB_2210545 ).

Techniques: Transfection, Control, Western Blot, Molecular Weight

Journal: eLife

Article Title: GCN2 eIF2 kinase promotes prostate cancer by maintaining amino acid homeostasis

doi: 10.7554/eLife.81083

Figure Lengend Snippet: ( A ) Immunoblot analyses for 22Rv1, PC-3, and GCN2 KO clones. Protein lysates were analyzed by immunoblot to measure the levels of GCN2, ATF4, p-eIF2α, total eIF2α, or actin. Molecular weight markers are shown in kilodaltons. The relative levels of p-eIF2α normalized to total eIF2α compared to wild-type (WT) parental control are indicated. ( B ) Growth curve of 22Rv1 WT, 22Rv1 GCN2 KO (clone 7), or 22Rv1 GCN2 KO (clone 7) cells overexpressing GCN2. Data from replicate wells ( N = 5) are shown as fold change (mean ± standard deviation [SD]) relative to day 0. Statistical significance was determined using a two-way analysis of variance (ANOVA) as described in ; ****p ≤ 0.0001. ( C ) Protein lysates prepared from the 22Rv1 WT, 22Rv1 GCN2 KO (clone 7), or 22Rv1 GCN2 KO (clone 7) cells expressing GCN2 were analyzed by immunoblot for GCN2, ATF4, ASNS, or actin.

Article Snippet: The primary antibodies used were as follows: phospho-GCN2-T899 (Abcam Cat. #ab75836, RRID: AB_1310260 ), total GCN2 (Cell Signaling Technology Cat. #3302, RRID: AB_2277617 ), total PERK (Cell Signaling Technology Cat. #3192, RRID: AB_2095847 ), total HRI (Santa Cruz Biotechnology Cat. #sc-365239, RRID: AB_10843794 ), total PKR (Cell Signaling Technology Cat. #12297, RRID: AB_2665515 ), phospho-eIF2α-S51 (Abcam Cat. #ab32157, RRID: AB_732117 ), total eIF2α (Cell Signaling Technology Cat. #5324, RRID: AB_10692650 ), ATF4 (Cell Signaling Technology Cat. #11815, RRID: AB_2616025 ), or custom rabbit polyclonal antibody which was prepared against full-length recombinant human ATF4 protein and affinity purified, ASNS (Cell Signaling Technology, Cat. #20843S), TRIB3 (Abcam Cat. #ab75846, RRID: AB_1310768 ), GADD34 (Proteintech Cat. #10449-1-AP, RRID: AB_2168724 ), SLC7A5/LAT1 (Cell Signaling Technology Cat. #5347, RRID: AB_10695104 ), SLC7A11/xCT (Cell Signaling Technology Cat. #12691, RRID: AB_2687474 ), SLC3A2/4F2 (Cell Signaling Technology Cat. #47213, RRID: AB_2799323 ), SCL7A1/CAT1 (Proteintech Cat. #14195-1-AP, RRID: AB_2190723 ), SLC1A4/ASCT1 (Cell Signaling Technology Cat. #8442, RRID: AB_10828382 ), SLC1A5/ASCT2 (Cell Signaling Technology Cat. #5345, RRID: AB_10621427 ), AR (Cell Signaling Technology Cat. #5153, RRID: AB_10691711 ), puromycin (Millipore Cat. #MABE343, RRID: AB_2566826 ), β-actin (Sigma-Aldrich Cat. #A5441, RRID: AB_476744 ), and β-tubulin (Cell Signaling Technology Cat. #2146, RRID: AB_2210545 ).

Techniques: Western Blot, Clone Assay, Molecular Weight, Control, Standard Deviation, Expressing

Journal: eLife

Article Title: GCN2 eIF2 kinase promotes prostate cancer by maintaining amino acid homeostasis

doi: 10.7554/eLife.81083

Figure Lengend Snippet: ( A ) C4-2B or 22Rv1 cells, cultured as indicated in the Materials and methods, or PC-3 cells cultured in HPLM media were treated with GCN2iB as indicated for up to 6 days. Cell growth was measured ( N = 5) and plotted as fold change (mean ± standard deviation [SD]) relative to day 0. Statistical significance was determined using a two-way analysis of variance (ANOVA) as described in ; ****p ≤ 0.0001. ( B ) 22Rv1 WT and 22Rv1 GCN2 KO (clone 7) cells were treated with GCN2iB as indicated for up to 6 days. Cell growth was measured ( N = 5) and plotted as fold change (mean ± SD) relative to day 0. Statistical significance was determined using a two-way ANOVA as described in ; ****p ≤ 0.0001. ( C ) Lysates were prepared from C4-2B, 22Rv1, or PC-3 cells treated with GCN2iB at the indicated concentrations or vehicle control (dimethyl sulfoxide, DMSO) for 48 hr and immunoblot analysis was carried out using antibodies that recognize p-GCN2-T899, total GCN2, p-eIF2α-S51, total eIF2α, ATF4, ASNS, TRIB3, LAT1 (SLC7A5), xCT (SLC7A11), 4F2 (SLC3A2) AR, or actin. Molecular weight markers are indicated in kilodaltons.

Article Snippet: The primary antibodies used were as follows: phospho-GCN2-T899 (Abcam Cat. #ab75836, RRID: AB_1310260 ), total GCN2 (Cell Signaling Technology Cat. #3302, RRID: AB_2277617 ), total PERK (Cell Signaling Technology Cat. #3192, RRID: AB_2095847 ), total HRI (Santa Cruz Biotechnology Cat. #sc-365239, RRID: AB_10843794 ), total PKR (Cell Signaling Technology Cat. #12297, RRID: AB_2665515 ), phospho-eIF2α-S51 (Abcam Cat. #ab32157, RRID: AB_732117 ), total eIF2α (Cell Signaling Technology Cat. #5324, RRID: AB_10692650 ), ATF4 (Cell Signaling Technology Cat. #11815, RRID: AB_2616025 ), or custom rabbit polyclonal antibody which was prepared against full-length recombinant human ATF4 protein and affinity purified, ASNS (Cell Signaling Technology, Cat. #20843S), TRIB3 (Abcam Cat. #ab75846, RRID: AB_1310768 ), GADD34 (Proteintech Cat. #10449-1-AP, RRID: AB_2168724 ), SLC7A5/LAT1 (Cell Signaling Technology Cat. #5347, RRID: AB_10695104 ), SLC7A11/xCT (Cell Signaling Technology Cat. #12691, RRID: AB_2687474 ), SLC3A2/4F2 (Cell Signaling Technology Cat. #47213, RRID: AB_2799323 ), SCL7A1/CAT1 (Proteintech Cat. #14195-1-AP, RRID: AB_2190723 ), SLC1A4/ASCT1 (Cell Signaling Technology Cat. #8442, RRID: AB_10828382 ), SLC1A5/ASCT2 (Cell Signaling Technology Cat. #5345, RRID: AB_10621427 ), AR (Cell Signaling Technology Cat. #5153, RRID: AB_10691711 ), puromycin (Millipore Cat. #MABE343, RRID: AB_2566826 ), β-actin (Sigma-Aldrich Cat. #A5441, RRID: AB_476744 ), and β-tubulin (Cell Signaling Technology Cat. #2146, RRID: AB_2210545 ).

Techniques: Cell Culture, Standard Deviation, Control, Western Blot, Molecular Weight

Journal: eLife

Article Title: GCN2 eIF2 kinase promotes prostate cancer by maintaining amino acid homeostasis

doi: 10.7554/eLife.81083

Figure Lengend Snippet: ATF4 expression was reduced in LNCaP, MR49F, C4-2B, or PC-3 cells using ATF4-specific siRNAs. Cell growth was measured in replicate wells ( N = 5) for up to 6 days and is plotted as fold change (mean ± standard deviation [SD]) relative to day 0. Statistical significance was determined using a two-way analysis of variance (ANOVA) as described in ; ****p ≤ 0.0001.

Article Snippet: The primary antibodies used were as follows: phospho-GCN2-T899 (Abcam Cat. #ab75836, RRID: AB_1310260 ), total GCN2 (Cell Signaling Technology Cat. #3302, RRID: AB_2277617 ), total PERK (Cell Signaling Technology Cat. #3192, RRID: AB_2095847 ), total HRI (Santa Cruz Biotechnology Cat. #sc-365239, RRID: AB_10843794 ), total PKR (Cell Signaling Technology Cat. #12297, RRID: AB_2665515 ), phospho-eIF2α-S51 (Abcam Cat. #ab32157, RRID: AB_732117 ), total eIF2α (Cell Signaling Technology Cat. #5324, RRID: AB_10692650 ), ATF4 (Cell Signaling Technology Cat. #11815, RRID: AB_2616025 ), or custom rabbit polyclonal antibody which was prepared against full-length recombinant human ATF4 protein and affinity purified, ASNS (Cell Signaling Technology, Cat. #20843S), TRIB3 (Abcam Cat. #ab75846, RRID: AB_1310768 ), GADD34 (Proteintech Cat. #10449-1-AP, RRID: AB_2168724 ), SLC7A5/LAT1 (Cell Signaling Technology Cat. #5347, RRID: AB_10695104 ), SLC7A11/xCT (Cell Signaling Technology Cat. #12691, RRID: AB_2687474 ), SLC3A2/4F2 (Cell Signaling Technology Cat. #47213, RRID: AB_2799323 ), SCL7A1/CAT1 (Proteintech Cat. #14195-1-AP, RRID: AB_2190723 ), SLC1A4/ASCT1 (Cell Signaling Technology Cat. #8442, RRID: AB_10828382 ), SLC1A5/ASCT2 (Cell Signaling Technology Cat. #5345, RRID: AB_10621427 ), AR (Cell Signaling Technology Cat. #5153, RRID: AB_10691711 ), puromycin (Millipore Cat. #MABE343, RRID: AB_2566826 ), β-actin (Sigma-Aldrich Cat. #A5441, RRID: AB_476744 ), and β-tubulin (Cell Signaling Technology Cat. #2146, RRID: AB_2210545 ).

Techniques: Expressing, Standard Deviation

Journal: eLife

Article Title: GCN2 eIF2 kinase promotes prostate cancer by maintaining amino acid homeostasis

doi: 10.7554/eLife.81083

Figure Lengend Snippet: ( A ) Lysates were prepared from BPH-1, LNCaP C4-2B, 22Rv1, or PC-3 cells and immunoblot analysis was carried out using antibodies that recognize p-GCN2-T899, total GCN2, p-eIF2α-S51, total eIF2α, ATF4, AR, or actin. Molecular weight markers are indicated in kilodaltons. ( B ) BPH-1 cells were transfected with siRNAs targeting GCN2, ATF4, or 4F2 (SLC3A2). Protein lysates were prepared and analyzed by immunoblot to determine the levels of GCN2, ATF4, 4F2 (SLC3A2), or actin as indicated. Molecular weight markers are indicated in kilodaltons. ( C ) Expression of GCN2, ATF4, or 4F2 (SLC3A2) was reduced in BPH-1 cells using two different gene-specific siRNAs as indicated and compared to a scramble siRNA control. Cell growth was measured for up to 6 days in replicate wells ( N = 5) as described in A . Statistical significance was determined using a two-way analysis of variance (ANOVA) as described in ; *p ≤ 0.05, **p ≤ 0.01. ( D ) Lysates were prepared from BPH-1 cells treated with GCN2iB at the indicated concentrations or vehicle control (DMSO) for 48 hr and immunoblot analysis was carried out using antibodies that recognize p-GCN2-T899, total GCN2, p-eIF2α-S51, total eIF2α, ATF4, ASNS, TRIB3, LAT1 (SLC7A5), xCT (SLC7A11), 4F2 (SLC3A2), AR, or actin. Molecular weight markers are indicated in kilodaltons. ( E ) BPH-1 cells were treated with 0.5–10 µM GCN2iB or vehicle (DMSO) control as indicated for up to 6 days. Cell growth was measured ( N = 5) and plotted as fold change (mean ± standard deviation [SD]) relative to day 0. Statistical significance was determined using a two-way ANOVA is shown in .

Article Snippet: The primary antibodies used were as follows: phospho-GCN2-T899 (Abcam Cat. #ab75836, RRID: AB_1310260 ), total GCN2 (Cell Signaling Technology Cat. #3302, RRID: AB_2277617 ), total PERK (Cell Signaling Technology Cat. #3192, RRID: AB_2095847 ), total HRI (Santa Cruz Biotechnology Cat. #sc-365239, RRID: AB_10843794 ), total PKR (Cell Signaling Technology Cat. #12297, RRID: AB_2665515 ), phospho-eIF2α-S51 (Abcam Cat. #ab32157, RRID: AB_732117 ), total eIF2α (Cell Signaling Technology Cat. #5324, RRID: AB_10692650 ), ATF4 (Cell Signaling Technology Cat. #11815, RRID: AB_2616025 ), or custom rabbit polyclonal antibody which was prepared against full-length recombinant human ATF4 protein and affinity purified, ASNS (Cell Signaling Technology, Cat. #20843S), TRIB3 (Abcam Cat. #ab75846, RRID: AB_1310768 ), GADD34 (Proteintech Cat. #10449-1-AP, RRID: AB_2168724 ), SLC7A5/LAT1 (Cell Signaling Technology Cat. #5347, RRID: AB_10695104 ), SLC7A11/xCT (Cell Signaling Technology Cat. #12691, RRID: AB_2687474 ), SLC3A2/4F2 (Cell Signaling Technology Cat. #47213, RRID: AB_2799323 ), SCL7A1/CAT1 (Proteintech Cat. #14195-1-AP, RRID: AB_2190723 ), SLC1A4/ASCT1 (Cell Signaling Technology Cat. #8442, RRID: AB_10828382 ), SLC1A5/ASCT2 (Cell Signaling Technology Cat. #5345, RRID: AB_10621427 ), AR (Cell Signaling Technology Cat. #5153, RRID: AB_10691711 ), puromycin (Millipore Cat. #MABE343, RRID: AB_2566826 ), β-actin (Sigma-Aldrich Cat. #A5441, RRID: AB_476744 ), and β-tubulin (Cell Signaling Technology Cat. #2146, RRID: AB_2210545 ).

Techniques: Western Blot, Molecular Weight, Transfection, Expressing, Control, Standard Deviation

Journal: eLife

Article Title: GCN2 eIF2 kinase promotes prostate cancer by maintaining amino acid homeostasis

doi: 10.7554/eLife.81083

Figure Lengend Snippet: ( A ) Volcano plot illustrating log 2 fold change in gene transcript levels with adjusted p value (−log 10 ) comparing LNCaP cells treated with GCN2iB (2 µM) versus vehicle control (DMSO) for 24 hr. Several amino acid transporters reduced by GCN2iB treatment are highlighted. ( B ) Plots from gene set enrichment analysis (GSEA) of gene expression in LNCaP cells treated with GCN2iB (2 µM) for 24 hr versus vehicle control. ( C ) Heat map displaying significantly downregulated SLC genes as indicated in panel A . The heat map compares gene transcript levels from LNCaP cells treated with vehicle (DMSO), or GCN2iB (2 µM) for 6 or 24 hr. Four biological replicates were measured for each treatment group. Transcript levels (normalized read counts) are shown relative to the average of the vehicle control samples for each gene. ( D ) Lysates were prepared from LNCaP cells treated with 2 µM GCN2iB or vehicle control (DMSO) for 6 or 24 hr and immunoblot analysis were carried out using antibodies that recognize ATF4, ASNS, xCT (SLC7A11), 4F2 (SLC3A2), CAT1 (SLC7A1), ASCT1 (SLC1A4), ASCT2 (SLC1A5), or actin. Molecular weight markers are indicated in kilodaltons. ( E ) 22Rv1 WT cells, 22Rv1 GCN2 KO cells, and 22Rv1 GCN2 KO complemented with GCN2 cells were cultured for 24 hr. Lysates were prepared and analyzed by immunoblot for the indicated proteins. ( F ) Amino acid uptake measurements in LNCaP and 22Rv1 cells treated with vehicle (DMSO) or GCN2iB (2 µM) for 24 hr. ( G ) Amino acid uptake measurements for 22Rv1 WT or 22Rv1 GCN2 KO cells cultured for 24 hr. Statistical significance was determined using an unpaired two-tailed t -test ( N = 4); *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001.

Article Snippet: The primary antibodies used were as follows: phospho-GCN2-T899 (Abcam Cat. #ab75836, RRID: AB_1310260 ), total GCN2 (Cell Signaling Technology Cat. #3302, RRID: AB_2277617 ), total PERK (Cell Signaling Technology Cat. #3192, RRID: AB_2095847 ), total HRI (Santa Cruz Biotechnology Cat. #sc-365239, RRID: AB_10843794 ), total PKR (Cell Signaling Technology Cat. #12297, RRID: AB_2665515 ), phospho-eIF2α-S51 (Abcam Cat. #ab32157, RRID: AB_732117 ), total eIF2α (Cell Signaling Technology Cat. #5324, RRID: AB_10692650 ), ATF4 (Cell Signaling Technology Cat. #11815, RRID: AB_2616025 ), or custom rabbit polyclonal antibody which was prepared against full-length recombinant human ATF4 protein and affinity purified, ASNS (Cell Signaling Technology, Cat. #20843S), TRIB3 (Abcam Cat. #ab75846, RRID: AB_1310768 ), GADD34 (Proteintech Cat. #10449-1-AP, RRID: AB_2168724 ), SLC7A5/LAT1 (Cell Signaling Technology Cat. #5347, RRID: AB_10695104 ), SLC7A11/xCT (Cell Signaling Technology Cat. #12691, RRID: AB_2687474 ), SLC3A2/4F2 (Cell Signaling Technology Cat. #47213, RRID: AB_2799323 ), SCL7A1/CAT1 (Proteintech Cat. #14195-1-AP, RRID: AB_2190723 ), SLC1A4/ASCT1 (Cell Signaling Technology Cat. #8442, RRID: AB_10828382 ), SLC1A5/ASCT2 (Cell Signaling Technology Cat. #5345, RRID: AB_10621427 ), AR (Cell Signaling Technology Cat. #5153, RRID: AB_10691711 ), puromycin (Millipore Cat. #MABE343, RRID: AB_2566826 ), β-actin (Sigma-Aldrich Cat. #A5441, RRID: AB_476744 ), and β-tubulin (Cell Signaling Technology Cat. #2146, RRID: AB_2210545 ).

Techniques: Control, Gene Expression, Western Blot, Molecular Weight, Cell Culture, Two Tailed Test

Journal: eLife

Article Title: GCN2 eIF2 kinase promotes prostate cancer by maintaining amino acid homeostasis

doi: 10.7554/eLife.81083

Figure Lengend Snippet: ( A ) LNCaP cells were treated with 2 µM GCN2iB or vehicle control (DMSO) for 6 or 24 hr, protein lysates were prepared, and immunoblotted for the indicated proteins. The bar graphs show the relative levels of the indicated proteins normalized to actin. Statistical significance was determined using an unpaired two-tailed t -test. Error bars indicate standard deviation (SD) ( N = 3); *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001. ( B ) Immunoblot analysis of PC-3 WT, PC-3 GCN2 KO (clone C-2), and PC-3 GCN2 KO (clone C-3) lysates using antibodies that recognize GCN2, ATF4, ASNS, LAT1 (SLC7A5), xCT (SLC7A11), 4F2 (SLC3A2), ASNS, or actin.

Article Snippet: The primary antibodies used were as follows: phospho-GCN2-T899 (Abcam Cat. #ab75836, RRID: AB_1310260 ), total GCN2 (Cell Signaling Technology Cat. #3302, RRID: AB_2277617 ), total PERK (Cell Signaling Technology Cat. #3192, RRID: AB_2095847 ), total HRI (Santa Cruz Biotechnology Cat. #sc-365239, RRID: AB_10843794 ), total PKR (Cell Signaling Technology Cat. #12297, RRID: AB_2665515 ), phospho-eIF2α-S51 (Abcam Cat. #ab32157, RRID: AB_732117 ), total eIF2α (Cell Signaling Technology Cat. #5324, RRID: AB_10692650 ), ATF4 (Cell Signaling Technology Cat. #11815, RRID: AB_2616025 ), or custom rabbit polyclonal antibody which was prepared against full-length recombinant human ATF4 protein and affinity purified, ASNS (Cell Signaling Technology, Cat. #20843S), TRIB3 (Abcam Cat. #ab75846, RRID: AB_1310768 ), GADD34 (Proteintech Cat. #10449-1-AP, RRID: AB_2168724 ), SLC7A5/LAT1 (Cell Signaling Technology Cat. #5347, RRID: AB_10695104 ), SLC7A11/xCT (Cell Signaling Technology Cat. #12691, RRID: AB_2687474 ), SLC3A2/4F2 (Cell Signaling Technology Cat. #47213, RRID: AB_2799323 ), SCL7A1/CAT1 (Proteintech Cat. #14195-1-AP, RRID: AB_2190723 ), SLC1A4/ASCT1 (Cell Signaling Technology Cat. #8442, RRID: AB_10828382 ), SLC1A5/ASCT2 (Cell Signaling Technology Cat. #5345, RRID: AB_10621427 ), AR (Cell Signaling Technology Cat. #5153, RRID: AB_10691711 ), puromycin (Millipore Cat. #MABE343, RRID: AB_2566826 ), β-actin (Sigma-Aldrich Cat. #A5441, RRID: AB_476744 ), and β-tubulin (Cell Signaling Technology Cat. #2146, RRID: AB_2210545 ).

Techniques: Control, Two Tailed Test, Standard Deviation, Western Blot

Journal: eLife

Article Title: GCN2 eIF2 kinase promotes prostate cancer by maintaining amino acid homeostasis

doi: 10.7554/eLife.81083

Figure Lengend Snippet: ( A ) Amino acid measurements of LNCaP cells treated with 2 µM GCN2iB or vehicle control (DMSO) for 8 hr. Bar graphs in the top panel show high abundance amino acids and the lower panel those with lower levels. The heat map on the right shows fold change in amino acid abundance for each biological replicate of GCN2iB-treated LNCaP cells versus the vehicle with the scale showing the highest fold change in yellow and lowest in purple. Statistical significance was determined using an unpaired two-tailed t -test. Error bars indicate standard deviation (SD) ( N = 3); *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p ≤ 0.0001. ( B ) LNCaP cells were treated with vehicle, GCN2iB (2 µM), vehicle + essential amino acids (EAA), or GCN2iB (2 µM) + EAA, and cell growth was measured for up to 6 days. Error bars indicate SD ( N = 5). Statistical significance was determined using a two-way analysis of variance (ANOVA) as described in ; ****p ≤ 0.0001. ( C ) Cell cycle analyses of LNCaP cells treated with vehicle, GCN2iB (2 µM), vehicle + EAA, or GCN2iB (2 µM) + EAA for 48 hr. Statistical significance was determined using a one-way ANOVA with Tukey’s multiple comparisons. Error bars indicate SD ( N = 3); ***p ≤ 0.001, ****p ≤ 0.0001. ( D ) Genome-wide tRNA charging analysis (CHARGE-seq) of LNCaP cells treated with vehicle (DMSO), GCN2iB (2 µM), or GCN2iB (2 µM) + EAA for 8 hr. The tRNA charging ratio is shown as a bar graph with fold change compared to vehicle. Only tRNA isoacceptors measured in LNCaP cells are shown. Error bars indicate SD ( N = 4). ( E ) tRNA charging percentage for tRNA His in LNCaP cells treated with vehicle, GCN2iB, or GCN2iB + EAA. Statistical significance was determine using a one-way ANOVA with Tukey’s multiple comparisons ( N = 4); ***p ≤ 0.001, ****p ≤ 0.0001. ( F ) LNCaP cells were treated with vehicle, GCN2iB (2 µM), GCN2iB (2 µM) + EAA, or GCN2iB (2 µM) combined with the indicated individual amino acids. Cell growth was measured at 4 days in triplicate wells ( N = 3). Statistical significance was determined using a one-way ANOVA with Tukey’s multiple comparisons. Error bars indicate SD; ****p ≤ 0.0001. ( G ) Cell cycle analysis of LNCaP cells were treated with vehicle, GCN2iB (2 µM), GCN2iB (2 µM) + histidine (200 µM), or with media lacking histidine for 48 hr. Statistical significance was determined using a one-way ANOVA with Tukey’s multiple comparisons. Error bars indicate SD ( N = 3); ***p ≤ 0.001, ****p ≤ 0.0001. ( H ) LNCaP cells were cultured in normal media, media supplemented with EAA mix, or media supplemented with histidine (200 µM) for 24 hr. Lysates were analyzed by Immunoblot using antibodies that recognize total or phosphorylated GCN2-T899, total or phosphorylated eIF2α−S51, ATF4, or actin. Molecular weight markers are presented in kilodaltons for each immunoblot panel. The relative levels of p-eIF2α normalized to total eIF2α compared to normal media (NM) control are indicated.

Article Snippet: The primary antibodies used were as follows: phospho-GCN2-T899 (Abcam Cat. #ab75836, RRID: AB_1310260 ), total GCN2 (Cell Signaling Technology Cat. #3302, RRID: AB_2277617 ), total PERK (Cell Signaling Technology Cat. #3192, RRID: AB_2095847 ), total HRI (Santa Cruz Biotechnology Cat. #sc-365239, RRID: AB_10843794 ), total PKR (Cell Signaling Technology Cat. #12297, RRID: AB_2665515 ), phospho-eIF2α-S51 (Abcam Cat. #ab32157, RRID: AB_732117 ), total eIF2α (Cell Signaling Technology Cat. #5324, RRID: AB_10692650 ), ATF4 (Cell Signaling Technology Cat. #11815, RRID: AB_2616025 ), or custom rabbit polyclonal antibody which was prepared against full-length recombinant human ATF4 protein and affinity purified, ASNS (Cell Signaling Technology, Cat. #20843S), TRIB3 (Abcam Cat. #ab75846, RRID: AB_1310768 ), GADD34 (Proteintech Cat. #10449-1-AP, RRID: AB_2168724 ), SLC7A5/LAT1 (Cell Signaling Technology Cat. #5347, RRID: AB_10695104 ), SLC7A11/xCT (Cell Signaling Technology Cat. #12691, RRID: AB_2687474 ), SLC3A2/4F2 (Cell Signaling Technology Cat. #47213, RRID: AB_2799323 ), SCL7A1/CAT1 (Proteintech Cat. #14195-1-AP, RRID: AB_2190723 ), SLC1A4/ASCT1 (Cell Signaling Technology Cat. #8442, RRID: AB_10828382 ), SLC1A5/ASCT2 (Cell Signaling Technology Cat. #5345, RRID: AB_10621427 ), AR (Cell Signaling Technology Cat. #5153, RRID: AB_10691711 ), puromycin (Millipore Cat. #MABE343, RRID: AB_2566826 ), β-actin (Sigma-Aldrich Cat. #A5441, RRID: AB_476744 ), and β-tubulin (Cell Signaling Technology Cat. #2146, RRID: AB_2210545 ).

Techniques: Control, Two Tailed Test, Standard Deviation, Genome Wide, Cell Cycle Assay, Cell Culture, Western Blot, Molecular Weight

Journal: eLife

Article Title: GCN2 eIF2 kinase promotes prostate cancer by maintaining amino acid homeostasis

doi: 10.7554/eLife.81083

Figure Lengend Snippet: ( A ) LNCaP, MR49F, C4-2B, 22Rv1, or PC-3 cells were transfected with GCN2 siRNA, ATF4 siRNA, or scrambled siRNA control for 48 hr and subjected to cell cycle analysis as described in the Materials and methods. The percentage of cells in G1, S, and G2-M are shown in the bar graphs. ( B ) 22Rv1 GCN2 KO and the parental WT were analyzed for cell cycle arrest. Statistical significance was determined using a one-way analysis of variance (ANOVA) with Tukey’s multiple comparisons. Error bars indicate standard deviation (SD) ( N = 3); *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001,****p ≤ 0.0001.

Article Snippet: The primary antibodies used were as follows: phospho-GCN2-T899 (Abcam Cat. #ab75836, RRID: AB_1310260 ), total GCN2 (Cell Signaling Technology Cat. #3302, RRID: AB_2277617 ), total PERK (Cell Signaling Technology Cat. #3192, RRID: AB_2095847 ), total HRI (Santa Cruz Biotechnology Cat. #sc-365239, RRID: AB_10843794 ), total PKR (Cell Signaling Technology Cat. #12297, RRID: AB_2665515 ), phospho-eIF2α-S51 (Abcam Cat. #ab32157, RRID: AB_732117 ), total eIF2α (Cell Signaling Technology Cat. #5324, RRID: AB_10692650 ), ATF4 (Cell Signaling Technology Cat. #11815, RRID: AB_2616025 ), or custom rabbit polyclonal antibody which was prepared against full-length recombinant human ATF4 protein and affinity purified, ASNS (Cell Signaling Technology, Cat. #20843S), TRIB3 (Abcam Cat. #ab75846, RRID: AB_1310768 ), GADD34 (Proteintech Cat. #10449-1-AP, RRID: AB_2168724 ), SLC7A5/LAT1 (Cell Signaling Technology Cat. #5347, RRID: AB_10695104 ), SLC7A11/xCT (Cell Signaling Technology Cat. #12691, RRID: AB_2687474 ), SLC3A2/4F2 (Cell Signaling Technology Cat. #47213, RRID: AB_2799323 ), SCL7A1/CAT1 (Proteintech Cat. #14195-1-AP, RRID: AB_2190723 ), SLC1A4/ASCT1 (Cell Signaling Technology Cat. #8442, RRID: AB_10828382 ), SLC1A5/ASCT2 (Cell Signaling Technology Cat. #5345, RRID: AB_10621427 ), AR (Cell Signaling Technology Cat. #5153, RRID: AB_10691711 ), puromycin (Millipore Cat. #MABE343, RRID: AB_2566826 ), β-actin (Sigma-Aldrich Cat. #A5441, RRID: AB_476744 ), and β-tubulin (Cell Signaling Technology Cat. #2146, RRID: AB_2210545 ).

Techniques: Transfection, Control, Cell Cycle Assay, Standard Deviation

Journal: eLife

Article Title: GCN2 eIF2 kinase promotes prostate cancer by maintaining amino acid homeostasis

doi: 10.7554/eLife.81083

Figure Lengend Snippet: ( A ) Gene-level depletion for LNCaP and 22Rv1 cells. The average log2 fold change for the single guide RNAs (sgRNAs) for each gene is shown on the x -axis. Significantly depleted genes (p ≤ 0.05) in LNCaP or 22Rv1 are indicated. Circle size indicates the number of significant sgRNAs. SLC genes in red are dependent on GCN2 for expression. ( B ) Plot of −Log 10 (p value) for depleted genes identified in CRISPR screen for LNCaP versus 22Rv1 cells. Significantly depleted genes (p ≤ 0.05) in LNCaP, 22Rv1 or both cell lines are indicated. SLC genes in red are GCN2 dependent. ( C ) Lysates from LNCaP cells were treated with 2 µM GCN2iB for 6 or 24 hr, or with vehicle (DMSO) were analyzed by immunoblot analyses using antibodies that recognize total or phosphorylated GCN2-T899, ATF4, 4F2 (SLC3A2), or actin. Molecular weight markers are indicated in kilodaltons for the panels. ( D ) LNCaP cells were cultured in standard culture conditions (NM: normal media), media supplemented with 200 µM histidine (+His), or media depleted of histidine (−His) for 24 hr. Lysates were analyzed by immunoblot analyses using antibodies that recognize total or phosphorylated GCN2-T899, ATF4, 4F2 (SLC3A2), or actin. ( E ) LNCaP cells were treated with 100 nM halofuginone (HF) for 2 and 6 hr or vehicle (DMSO). Lysates were analyzed by Immunoblot using antibodies that recognize the indicated proteins. ( F ) 4F2 (SLC3A2) expression was reduced in LNCaP or 22Rv1 cells using two different siRNAs or scramble siRNA as a control. Cell growth was measured in replicate wells ( N = 5) for up to 6 days and are plotted relative to day 0 (mean ± standard deviation [SD]). Statistical significance was determined using a two-way analysis of variance (ANOVA) as described in ; ****p ≤ 0.0001. ( G ) LNCaP cells transfected with two different siRNAs targeting 4F2 (SLC3A2) or scramble siRNA for 48 hr. Lysate was prepared and analyzed by immunoblot using antibodies that recognize total or phosphorylated GCN2-T899, total or phosphorylated eIF2α−S51, ATF4, 4F2 (SLC3A2), or actin. ( H ) LNCaP cells stably overexpressing SLC3CA2 or vector control were transfected with two different siRNAs targeting GCN2 or scrambled control. Cells were then treated with GCN2iB (2 µM) or vehicle and growth was measured in replicate wells ( N = 5) and is plotted relative to day 0 (mean ± SD). Statistical significance was determined using a two-way ANOVA as described in ; **p ≤ 0.01, ****p ≤ 0.0001. ( I ) Amino acid measurements of LNCaP cells transfected siRNA targeting GCN2 ( N = 4), 4F2 (SLC3A2, N = 4), or scramble control ( N = 8). Two separate bar graphs show high abundance (top) and low abundance (bottom) amino acids. Statistical significance was determined using a two-way ANOVA as described in . Error bars indicate SD; *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001; ****p ≤ 0.0001.

Article Snippet: The primary antibodies used were as follows: phospho-GCN2-T899 (Abcam Cat. #ab75836, RRID: AB_1310260 ), total GCN2 (Cell Signaling Technology Cat. #3302, RRID: AB_2277617 ), total PERK (Cell Signaling Technology Cat. #3192, RRID: AB_2095847 ), total HRI (Santa Cruz Biotechnology Cat. #sc-365239, RRID: AB_10843794 ), total PKR (Cell Signaling Technology Cat. #12297, RRID: AB_2665515 ), phospho-eIF2α-S51 (Abcam Cat. #ab32157, RRID: AB_732117 ), total eIF2α (Cell Signaling Technology Cat. #5324, RRID: AB_10692650 ), ATF4 (Cell Signaling Technology Cat. #11815, RRID: AB_2616025 ), or custom rabbit polyclonal antibody which was prepared against full-length recombinant human ATF4 protein and affinity purified, ASNS (Cell Signaling Technology, Cat. #20843S), TRIB3 (Abcam Cat. #ab75846, RRID: AB_1310768 ), GADD34 (Proteintech Cat. #10449-1-AP, RRID: AB_2168724 ), SLC7A5/LAT1 (Cell Signaling Technology Cat. #5347, RRID: AB_10695104 ), SLC7A11/xCT (Cell Signaling Technology Cat. #12691, RRID: AB_2687474 ), SLC3A2/4F2 (Cell Signaling Technology Cat. #47213, RRID: AB_2799323 ), SCL7A1/CAT1 (Proteintech Cat. #14195-1-AP, RRID: AB_2190723 ), SLC1A4/ASCT1 (Cell Signaling Technology Cat. #8442, RRID: AB_10828382 ), SLC1A5/ASCT2 (Cell Signaling Technology Cat. #5345, RRID: AB_10621427 ), AR (Cell Signaling Technology Cat. #5153, RRID: AB_10691711 ), puromycin (Millipore Cat. #MABE343, RRID: AB_2566826 ), β-actin (Sigma-Aldrich Cat. #A5441, RRID: AB_476744 ), and β-tubulin (Cell Signaling Technology Cat. #2146, RRID: AB_2210545 ).

Techniques: Expressing, CRISPR, Western Blot, Molecular Weight, Cell Culture, Control, Standard Deviation, Transfection, Stable Transfection, Plasmid Preparation

Journal: eLife

Article Title: GCN2 eIF2 kinase promotes prostate cancer by maintaining amino acid homeostasis

doi: 10.7554/eLife.81083

Figure Lengend Snippet: ( A ) 4F2 (SLC3A2) and ATF4 mRNA were measured by qRT-PCR as described in the Materials and methods in LNCaP cells treated with 2 µM GCN2iB for 6 or 24 hr or vehicle control (DMSO), ( B ) cultured in standard culture conditions (NM: normal media), media supplemented with 200 µM histidine (+His), or media depleted of histidine (− His) for 24 hr, or ( C ) treated with 100 nM halofuginone (HF) for 2 or 6 hr or untreated (DMSO control). Error bars indicate standard deviation (SD) ( N = 3). An unpaired two-tailed t -test was used to determine statistical significance; *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p ≤ 0.0001.

Article Snippet: The primary antibodies used were as follows: phospho-GCN2-T899 (Abcam Cat. #ab75836, RRID: AB_1310260 ), total GCN2 (Cell Signaling Technology Cat. #3302, RRID: AB_2277617 ), total PERK (Cell Signaling Technology Cat. #3192, RRID: AB_2095847 ), total HRI (Santa Cruz Biotechnology Cat. #sc-365239, RRID: AB_10843794 ), total PKR (Cell Signaling Technology Cat. #12297, RRID: AB_2665515 ), phospho-eIF2α-S51 (Abcam Cat. #ab32157, RRID: AB_732117 ), total eIF2α (Cell Signaling Technology Cat. #5324, RRID: AB_10692650 ), ATF4 (Cell Signaling Technology Cat. #11815, RRID: AB_2616025 ), or custom rabbit polyclonal antibody which was prepared against full-length recombinant human ATF4 protein and affinity purified, ASNS (Cell Signaling Technology, Cat. #20843S), TRIB3 (Abcam Cat. #ab75846, RRID: AB_1310768 ), GADD34 (Proteintech Cat. #10449-1-AP, RRID: AB_2168724 ), SLC7A5/LAT1 (Cell Signaling Technology Cat. #5347, RRID: AB_10695104 ), SLC7A11/xCT (Cell Signaling Technology Cat. #12691, RRID: AB_2687474 ), SLC3A2/4F2 (Cell Signaling Technology Cat. #47213, RRID: AB_2799323 ), SCL7A1/CAT1 (Proteintech Cat. #14195-1-AP, RRID: AB_2190723 ), SLC1A4/ASCT1 (Cell Signaling Technology Cat. #8442, RRID: AB_10828382 ), SLC1A5/ASCT2 (Cell Signaling Technology Cat. #5345, RRID: AB_10621427 ), AR (Cell Signaling Technology Cat. #5153, RRID: AB_10691711 ), puromycin (Millipore Cat. #MABE343, RRID: AB_2566826 ), β-actin (Sigma-Aldrich Cat. #A5441, RRID: AB_476744 ), and β-tubulin (Cell Signaling Technology Cat. #2146, RRID: AB_2210545 ).

Techniques: Quantitative RT-PCR, Control, Cell Culture, Standard Deviation, Two Tailed Test

Journal: eLife

Article Title: GCN2 eIF2 kinase promotes prostate cancer by maintaining amino acid homeostasis

doi: 10.7554/eLife.81083

Figure Lengend Snippet: ( A ) LNCaP cells were treated with GCN2iB (2 µM) or vehicle (DMSO) control in the presence or absence of salubrinal (50 µM) for 48 hr. Protein lysates were prepared and analyzed by immunoblot using antibodies that recognize total or phosphorylated GCN2, total or phosphorylated eIF2α, ATF4, 4F2 (SLC3A2), or actin as indicated. ( B ) LNCaP cells transfected with empty vector (EV) control or pMSCV-GADD34-puro expression plasmid encoding the human GADD34 gene were analyzed by immunoblot as indicated in panel A. ( C ) Protein lysates prepared from LNCaP or 22Rv1 stably expressing empty vector (EV) control or 4F2 (SLC3A2) were analyzed by immunoblot using antibodies that recognize total or phosphorylated GCN2, total or phosphorylated eIF2α(S-51), ATF4, or actin as indicated. ( D ) Growth of LNCaP and 22Rv1 cells stably expressing empty vector (EV) control or 4F2 (SLC3A2) was measured in replicate wells ( N = 5) for up to 4 days and plotted as fold change (mean ± standard deviation [SD]) relative to day 0. Statistical significance was determined using a two-way analysis of variance (ANOVA) as described in ; ****p ≤ 0.0001.

Article Snippet: The primary antibodies used were as follows: phospho-GCN2-T899 (Abcam Cat. #ab75836, RRID: AB_1310260 ), total GCN2 (Cell Signaling Technology Cat. #3302, RRID: AB_2277617 ), total PERK (Cell Signaling Technology Cat. #3192, RRID: AB_2095847 ), total HRI (Santa Cruz Biotechnology Cat. #sc-365239, RRID: AB_10843794 ), total PKR (Cell Signaling Technology Cat. #12297, RRID: AB_2665515 ), phospho-eIF2α-S51 (Abcam Cat. #ab32157, RRID: AB_732117 ), total eIF2α (Cell Signaling Technology Cat. #5324, RRID: AB_10692650 ), ATF4 (Cell Signaling Technology Cat. #11815, RRID: AB_2616025 ), or custom rabbit polyclonal antibody which was prepared against full-length recombinant human ATF4 protein and affinity purified, ASNS (Cell Signaling Technology, Cat. #20843S), TRIB3 (Abcam Cat. #ab75846, RRID: AB_1310768 ), GADD34 (Proteintech Cat. #10449-1-AP, RRID: AB_2168724 ), SLC7A5/LAT1 (Cell Signaling Technology Cat. #5347, RRID: AB_10695104 ), SLC7A11/xCT (Cell Signaling Technology Cat. #12691, RRID: AB_2687474 ), SLC3A2/4F2 (Cell Signaling Technology Cat. #47213, RRID: AB_2799323 ), SCL7A1/CAT1 (Proteintech Cat. #14195-1-AP, RRID: AB_2190723 ), SLC1A4/ASCT1 (Cell Signaling Technology Cat. #8442, RRID: AB_10828382 ), SLC1A5/ASCT2 (Cell Signaling Technology Cat. #5345, RRID: AB_10621427 ), AR (Cell Signaling Technology Cat. #5153, RRID: AB_10691711 ), puromycin (Millipore Cat. #MABE343, RRID: AB_2566826 ), β-actin (Sigma-Aldrich Cat. #A5441, RRID: AB_476744 ), and β-tubulin (Cell Signaling Technology Cat. #2146, RRID: AB_2210545 ).

Techniques: Control, Western Blot, Transfection, Plasmid Preparation, Expressing, Stable Transfection, Standard Deviation

Journal: eLife

Article Title: GCN2 eIF2 kinase promotes prostate cancer by maintaining amino acid homeostasis

doi: 10.7554/eLife.81083

Figure Lengend Snippet: ( A ) WT or GCN2 KO 22Rv1 (clone 7) cells were injected subcutaneously into the dorsal flank of mice as described in the Materials and methods. Tumor volume (TV) was measured on indicated days and is plotted as average TV ± standard error of the mean (SEM) ( N = 4). Statistical significance was determined using a two-way analysis of variance (ANOVA) with Sidak’s multiple comparison; *p ≤ 0.05; ****p ≤ 0.0001. On the right bar graph, the final tumor weight was measured at endpoint and statistical significance was determined using an unpaired two-tailed t -test. Error bars indicate standard deviation (SD); **p ≤ 0.01. ( B ) Protein lysates were prepared from WT and GCN2 KO 22Rv1 tumors and analyzed by immunoblot to measure total GCN2, ATF4, LAT1 (SLC7A5), xCT (SLC7A11), 4F2 (SLC3A2), androgen receptor (AR), AR splice variant 7 (AR-V7), or actin. Molecular weight markers are indicated in kilodaltons for each immunoblot panel. The levels of the SLC proteins normalized to actin are shown in the bar graph (right panels). Statistical significance was determined using an unpaired two-tailed t -test. Error bars indicate SD ( N = 4); *p ≤ 0.05; ***p ≤ 0.001. ( C ) Tumor growth of PC-3 WT and PC-3 GCN2 KO (clone 3) cells was analyzed in a mouse xenograft study as in A. Statistical significance was determined using a two-way ANOVA with Sidak’s multiple comparison. Error bars indicate SEM ( N = 5); ***p ≤ 0.001; ****p ≤ 0.0001. On the right bar graph, the final tumor weight was measured at endpoint. Statistical significance was determined using an unpaired two-tailed t -test. Error bars indicate SD ( N = 5); *p ≤ 0.01. ( D ) Protein lysates were prepared from the PC-3 WT and PC-3 GCN2 KO tumors and analyzed by immunoblot for the indicated proteins. (Right panels) Quantification of protein levels of LAT1 (SLC7A5), xCT (SLC7A11), and 4F2 (SLC3A2) normalized to actin are shown in the bar graphs. Statistical significance was determined using an unpaired two-tailed t -test. Error bars indicate SD ( N = 4); **p ≤ 0.01. ( E ) 22Rv1 WT ( N = 4), 22Rv1 GCN2 KO (clone 7, N = 5), and 22Rv1 ATF4 KO ( N = 5) were evaluated in the mouse xenograft model. Tumor volumes were measured on the indicated days. Error bars indicated SEM. ( F ) Amino acid measurements of 22Rv1 WT, 22Rv1 GCN2 KO, and 22Rv1 ATF4 KO tumors. Two separate bar graphs show high abundance (top) and low abundance (bottom) amino acids. Statistical significance was determined one-way ANOVA with Tukey’s multiple comparisons. Error bars indicate SD ( N = 4); # p ≤ 0.1, *p ≤ 0.05. ( G ) 22Rv1 WT and 22Rv1 GCN2 KO (clone 7) cells were analyzed in a xenograft model as described for ( A ), with or without supplementation of essential amino acid (EAA) in the drinking water. Tumor volume was measured on indicated days. 22Rv1 WT ( N = 4) and 22Rv1 KO ( N = 5) are the same tumor growth curves shown in ( E ). 22Rv1 WT + EAA ( N = 5), 22Rv1 GCN2 KO + EAA ( N = 5). Statistical significance was determined using a two-way ANOVA with Sidak’s multiple comparison; ****p ≤ 0.0001. ( H ) Amino acid measurements for 22Rv1 WT, 22Rv1 GCN2, and 22Rv1 GCN2 KO + EAA tumors. Bar graphs show only amino acids present in EAA supplemented water. Statistical significance was determined using a one-way ANOVA with Tukey’s multiple comparisons. Error bars indicated SD ( N = 4); # p ≤ 0.1; *p ≤ 0.05; **p ≤ 0.01. ( I ) Tumor growth curves for 22Rv1 WT or 22Rv1 GCN2 KO (clone 11) transduced with 4F2 (SLC3A2) lentivirus (WT + 4F2 and GCN2 KO + 4F2) or empty vector (WT + EV and GCN2 KO + EV). Tumor volumes were measured on indicated days. Error bars indicate SEM ( N = 5). Statistical significance was determined using a two-way ANOVA with Sidak’s multiple comparison; ****p ≤ 0.0001.

Article Snippet: The primary antibodies used were as follows: phospho-GCN2-T899 (Abcam Cat. #ab75836, RRID: AB_1310260 ), total GCN2 (Cell Signaling Technology Cat. #3302, RRID: AB_2277617 ), total PERK (Cell Signaling Technology Cat. #3192, RRID: AB_2095847 ), total HRI (Santa Cruz Biotechnology Cat. #sc-365239, RRID: AB_10843794 ), total PKR (Cell Signaling Technology Cat. #12297, RRID: AB_2665515 ), phospho-eIF2α-S51 (Abcam Cat. #ab32157, RRID: AB_732117 ), total eIF2α (Cell Signaling Technology Cat. #5324, RRID: AB_10692650 ), ATF4 (Cell Signaling Technology Cat. #11815, RRID: AB_2616025 ), or custom rabbit polyclonal antibody which was prepared against full-length recombinant human ATF4 protein and affinity purified, ASNS (Cell Signaling Technology, Cat. #20843S), TRIB3 (Abcam Cat. #ab75846, RRID: AB_1310768 ), GADD34 (Proteintech Cat. #10449-1-AP, RRID: AB_2168724 ), SLC7A5/LAT1 (Cell Signaling Technology Cat. #5347, RRID: AB_10695104 ), SLC7A11/xCT (Cell Signaling Technology Cat. #12691, RRID: AB_2687474 ), SLC3A2/4F2 (Cell Signaling Technology Cat. #47213, RRID: AB_2799323 ), SCL7A1/CAT1 (Proteintech Cat. #14195-1-AP, RRID: AB_2190723 ), SLC1A4/ASCT1 (Cell Signaling Technology Cat. #8442, RRID: AB_10828382 ), SLC1A5/ASCT2 (Cell Signaling Technology Cat. #5345, RRID: AB_10621427 ), AR (Cell Signaling Technology Cat. #5153, RRID: AB_10691711 ), puromycin (Millipore Cat. #MABE343, RRID: AB_2566826 ), β-actin (Sigma-Aldrich Cat. #A5441, RRID: AB_476744 ), and β-tubulin (Cell Signaling Technology Cat. #2146, RRID: AB_2210545 ).

Techniques: Injection, Comparison, Two Tailed Test, Standard Deviation, Western Blot, Variant Assay, Molecular Weight, Transduction, Plasmid Preparation

Journal: eLife

Article Title: GCN2 eIF2 kinase promotes prostate cancer by maintaining amino acid homeostasis

doi: 10.7554/eLife.81083

Figure Lengend Snippet: ( A ) Lysates from 22Rv1 WT, 22Rv1 GCN2 KO, and 22Rv1 ATF4 KO tumors were subjected to immunoblot analyses to measure total or phosphorylated GCN2, total or phosphorylated eIF2α, ATF4, LAT1 (SLC7A5), xCT (SLC7A11), 4F2 (SLC3A2), CAT1 (SLC7A1), ASCT1 (SLC1A4), ASCT2 (SLC1A5), androgen receptor (AR), AR splice variant 7 (AR-V7), or actin. Molecular weight markers are indicated in kilodaltons for each immunoblot panel. Levels of the indicated proteins normalized to appropriate control are shown in the bar graph on the right. Statistical significance was determined using a one-way analysis of variance (ANOVA) with Tukey’s multiple comparisons. Error bars indicate standard deviation (SD) ( N = 4); ns, p > 0.05; *p ≤ 0.05, **p ≤ 0.01, ***p ≤0.001. ( B ) LNCaP cells were transfected with siRNAs targeting GCN2 ( N = 4), ATF4 ( N = 4), or scramble control ( N = 8) for 48 hr. Amino acid levels were determined as described in the Materials and methods. Error bars indicate SD. Statistical significance was determined using a one-way ANOVA with Tukey’s multiple comparisons; # p ≤ 0.1, *p ≤ 0.05, **p ≤ 0.01, ***p ≤0.001, ****p ≤0.0001. Scramble control and GCN2 knockdown samples are the same as in .

Article Snippet: The primary antibodies used were as follows: phospho-GCN2-T899 (Abcam Cat. #ab75836, RRID: AB_1310260 ), total GCN2 (Cell Signaling Technology Cat. #3302, RRID: AB_2277617 ), total PERK (Cell Signaling Technology Cat. #3192, RRID: AB_2095847 ), total HRI (Santa Cruz Biotechnology Cat. #sc-365239, RRID: AB_10843794 ), total PKR (Cell Signaling Technology Cat. #12297, RRID: AB_2665515 ), phospho-eIF2α-S51 (Abcam Cat. #ab32157, RRID: AB_732117 ), total eIF2α (Cell Signaling Technology Cat. #5324, RRID: AB_10692650 ), ATF4 (Cell Signaling Technology Cat. #11815, RRID: AB_2616025 ), or custom rabbit polyclonal antibody which was prepared against full-length recombinant human ATF4 protein and affinity purified, ASNS (Cell Signaling Technology, Cat. #20843S), TRIB3 (Abcam Cat. #ab75846, RRID: AB_1310768 ), GADD34 (Proteintech Cat. #10449-1-AP, RRID: AB_2168724 ), SLC7A5/LAT1 (Cell Signaling Technology Cat. #5347, RRID: AB_10695104 ), SLC7A11/xCT (Cell Signaling Technology Cat. #12691, RRID: AB_2687474 ), SLC3A2/4F2 (Cell Signaling Technology Cat. #47213, RRID: AB_2799323 ), SCL7A1/CAT1 (Proteintech Cat. #14195-1-AP, RRID: AB_2190723 ), SLC1A4/ASCT1 (Cell Signaling Technology Cat. #8442, RRID: AB_10828382 ), SLC1A5/ASCT2 (Cell Signaling Technology Cat. #5345, RRID: AB_10621427 ), AR (Cell Signaling Technology Cat. #5153, RRID: AB_10691711 ), puromycin (Millipore Cat. #MABE343, RRID: AB_2566826 ), β-actin (Sigma-Aldrich Cat. #A5441, RRID: AB_476744 ), and β-tubulin (Cell Signaling Technology Cat. #2146, RRID: AB_2210545 ).

Techniques: Western Blot, Variant Assay, Molecular Weight, Control, Standard Deviation, Transfection, Knockdown

Journal: eLife

Article Title: GCN2 eIF2 kinase promotes prostate cancer by maintaining amino acid homeostasis

doi: 10.7554/eLife.81083

Figure Lengend Snippet: Male NSG mice were injected subcutaneously with LNCaP ( N = 5) ( A ) or 22Rv1 ( N = 4) ( B ) cells, or alternatively implanted with tumor fragments from an androgen-sensitive tumor TM00298 ( N = 5) ( C ). Male castrated NSG mice were implanted with tumor fragments from LuCaP-35 CR tumors ( N = 5) ( D ). Mice were treated with vehicle or 30 mg/kg GCN2iB twice daily for 5 days/week and tumor volumes were measured on indicated days. Statistical significance was determined using a two-way analysis of variance (ANOVA) with Sidak’s multiple comparison. Error bars indicate standard error of the mean (SEM); *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p ≤ 0.0001. Final tumor weight was measured at endpoint and is represented in bar graphs (right panels). Statistical significance was determined using an unpaired two-tailed t -test. Error bars indicate standard deviation (SD); *p ≤ 0.05. ( E ) Protein lysates were prepared from 22Rv1 tumors treated with vehicle or GCN2iB and analyzed by immunoblot for phosphorylated GCN2-T899, ATF4, LAT1 (SLC7A5), xCT (SLC7A11), and 4F2 (SLC3A2), and actin. The levels of the SLC proteins normalized to actin are shown. Phosphorylated GCN2-T899 was normalized to total GCN2. Statistical significance was determined using an unpaired two-tailed t -test. Error bars indicate SD ( N = 4); *p ≤ 0.05. ( F ) Amino acid measurements of 22Rv1 tumors treated with vehicle or GCN2iB. Bar graphs show high abundance (top) and low abundance (bottom) amino acids. Statistical significance was determined using an unpaired two-tailed t -test. Error bars indicate SD ( N = 4); # p ≤ 0.1; *p ≤ 0.05; **p ≤ 0.01. ( G ) Pearson correlation between p-GCN2-T899 and 4F2 (SLC3A2) histoscores calculated from IHC staining from a prostate tumor microarray (Biomax PR807c) containing normal ( N = 10), hyperplasia ( N = 20), and malignant ( N = 50) for all tissues (combined) or Gleason scores 4 and 5. The center lines depict linear regression (95% confidence intervals). Not all samples were analyzed due to damaged/quality of tissue samples. Levels of p-GCN2-T899 and 4F2 (SLC3A2) were measured by IHC staining and QuPath was used to determine the histoscore. Two representative cases are shown for high (Case 1) and low (Case 2) p-GCN2-T899 and 4F2 (SLC3A2) staining. Scale bar indicates 200 µm (main image) and 20 µm (insert). ( H ) Correlation of expression of 4F2 (SLC3A2) and a GCN2-dependent gene signature in prostate adenocarcinoma (PRAD, N = 551) from the Cancer Genome Atlas (TCGA). The GCN2-dependepent gene signature was derived from RNA-seq data as described in the Materials and methods.

Article Snippet: The primary antibodies used were as follows: phospho-GCN2-T899 (Abcam Cat. #ab75836, RRID: AB_1310260 ), total GCN2 (Cell Signaling Technology Cat. #3302, RRID: AB_2277617 ), total PERK (Cell Signaling Technology Cat. #3192, RRID: AB_2095847 ), total HRI (Santa Cruz Biotechnology Cat. #sc-365239, RRID: AB_10843794 ), total PKR (Cell Signaling Technology Cat. #12297, RRID: AB_2665515 ), phospho-eIF2α-S51 (Abcam Cat. #ab32157, RRID: AB_732117 ), total eIF2α (Cell Signaling Technology Cat. #5324, RRID: AB_10692650 ), ATF4 (Cell Signaling Technology Cat. #11815, RRID: AB_2616025 ), or custom rabbit polyclonal antibody which was prepared against full-length recombinant human ATF4 protein and affinity purified, ASNS (Cell Signaling Technology, Cat. #20843S), TRIB3 (Abcam Cat. #ab75846, RRID: AB_1310768 ), GADD34 (Proteintech Cat. #10449-1-AP, RRID: AB_2168724 ), SLC7A5/LAT1 (Cell Signaling Technology Cat. #5347, RRID: AB_10695104 ), SLC7A11/xCT (Cell Signaling Technology Cat. #12691, RRID: AB_2687474 ), SLC3A2/4F2 (Cell Signaling Technology Cat. #47213, RRID: AB_2799323 ), SCL7A1/CAT1 (Proteintech Cat. #14195-1-AP, RRID: AB_2190723 ), SLC1A4/ASCT1 (Cell Signaling Technology Cat. #8442, RRID: AB_10828382 ), SLC1A5/ASCT2 (Cell Signaling Technology Cat. #5345, RRID: AB_10621427 ), AR (Cell Signaling Technology Cat. #5153, RRID: AB_10691711 ), puromycin (Millipore Cat. #MABE343, RRID: AB_2566826 ), β-actin (Sigma-Aldrich Cat. #A5441, RRID: AB_476744 ), and β-tubulin (Cell Signaling Technology Cat. #2146, RRID: AB_2210545 ).

Techniques: Injection, Comparison, Two Tailed Test, Standard Deviation, Western Blot, Immunohistochemistry, Microarray, Staining, Expressing, Derivative Assay, RNA Sequencing